New Drug Approvals

Home » Uncategorized » ATL1102 for MS – Toxicology Study Main Findings

ATL1102 for MS – Toxicology Study Main Findings

DRUG APPROVALS BY DR ANTHONY MELVIN CRASTO .....FOR BLOG HOME CLICK HERE

ORGANIC SPECTROSCOPY

Read all about Organic Spectroscopy on ORGANIC SPECTROSCOPY INTERNATIONAL 

Archives

Categories

Recent Posts

Blog Stats

  • 4,850,833 hits

Unknown's avatar

Enter your email address to follow this blog and receive notifications of new posts by email.

Join 37.9K other subscribers

add to any

Share

Sequence TypeDNA fragment
CTGAGTCTGTTTTCCATTCT

ATL 1102

The antisense oligonucleotide is complementary to a region in the 3’UTR of human ITGA4 (integrin alpha 4) cDNA whose sequence is 5′-CTGAGTCTGTTTTCCATTCT-3′
Phosphorothioate antisense oligonucleotide consisting of a 9-nucleotide central region of deoxynucleotides flanked by 3 2′-O-methoxyethyl (2′-MOE) nucleotides on the 5′ end and 8 2′-MOE nucleotides on the 3′ end.

TOORAK, Australia, April 1, 2014 /PRNewswire/ — Antisense Therapeutics Limited (“ANP” or the “Company”) is pleased to advise that results from a chronic toxicity study in monkeys indicate that ATL1102, an antisense oligonucleotide currently under development for the treatment of multiple sclerosis (MS), was well-tolerated when given subcutaneously for a 6-month dosing period at the 2 dose levels tested (1.5 and 3mg/kg/dose). The Company believes that the preclinical and clinical experience to date with ATL1102 should allow dosing in future trials at or above the 1.5 mg/kg/dose level.

read at

http://www.sys-con.com/node/3037721

 

ATL-1102
ISIS-107248
TV-1102

ITGA4 Expression Inhibitors

Signal Transduction Modulators

PHASE 2

Antisense Therapeutics
Isis Pharmaceuticals

Antisense Therapeutics Limited (ASX: ANP) is an Australian publicly listed biopharmaceutical drug discovery and development company. Its mission is to create, develop and commercialise second generation antisense pharmaceuticals for large unmet markets. ANP has 4 products in its development pipeline that it has in-licensed from Isis Pharmaceuticals Inc., world leaders in antisense drug development and commercialisation – ATL1102 (injection) which has successfully completed a Phase II efficacy and safety trial, significantly reducing the number of brain lesions in patients with multiple sclerosis, ATL1103 a second-generation antisense drug designed to block GHr production and thereby lower blood IGF-I levels and is in clinical development as a potential treatment for growth and other GH-IGF-I disorders, ATL1102 (inhaled) which is at the pre-clinical research stage as a potential treatment for asthma and ATL1101 a second-generation antisense drug at the pre-clinical stage being investigated as a potential treatment for cancer.

ATL1102 is a second generation antisense inhibitor of CD49d, a subunit of VLA-4 (Very Late Antigen-4). In inflammation, white blood cells (leukocytes) move out of the bloodstream into the inflamed tissue, for example, the Central Nervous System (CNS) in MS, and the lung airways in asthma. The inhibition of VLA-4 may prevent white blood cells from entering sites of inflammation, thereby slowing progression of the disease. VLA-4 is a clinically validated target in the treatment of MS. Antisense inhibition of VLA-4 has demonstrated positive effects in a number of animal models of inflammatory disease including MS with the MS animal data having been published in a peer reviewed scientific journal. ATL1102 was previously shown by Antisense Therapeutics to be highly effective in reducing MS lesions in a Phase IIa clinical trial in MS patients.

ATL-1102 is an antisense oligonucleotide in phase II clinical trials at Isis Pharmaceuticals and Antisense Therapeutics for the treatment of relapsing-remitting multiple sclerosis (MS) in a subcutaneous injection formulation. Phase I clinical trials in a subcutaneous injections for stem cell mobilization and preclinical studies of an inhalation formulation of the drug candidate for the treatment of asthma are also being conducted at Antisense Therapeutics.

ATL-1102 is complementary to nt 4288-4207 (3’UTR) of human integrin alpha 4 (ITGA4) cDNA, and thus inhibits ITGA4 expression, blocking the synthesis of CD49d, a subunit of very late antigen-4 (VLA-4). VLA-4 is known to play a part in both the onset and progression of MS, and its inhibition may prevent white blood cells from entering the central nervous system.

ATL-1102 was originally developed at Isis Pharmaceuticals. In December 2001, Isis and Circadian Technologies formed Antisense Therapeutics, established to focus on the discovery and development of antisense therapeutics. As part of the company’s formation, Antisense Therapeutics received a license to ATL-1102 and entered into a five-year antisense drug discovery and development program with Isis. In 2008, Antisense licensed ATL-1102 to Teva. In 2010, Teva terminated its licensee agreement with Antisense for the development of ATL-1102 for the treatment of relapsing-remitting multiple sclerosis. The company stated that the compound was not on line with its preferred product pipeline. In 2001, ATL-1102 was licensed to Antisense Therapeutics by Isis Pharmaceuticals. In 2012, development and commercialization rights to the product were licensed to Tianjin International Joint Academy of Biotechnology and

Contact Information:
Website: www.antisense.com.au
Managing Director: Mark Diamond +61 (3) 9827 8999
USA Investor/Media: Joshua Drumm +(1) 212 375 2664;jdrumm@tiberend.com
Australia Investor/Media: Simon Watkin +61 (0)413 153 272;simon@marketconnect.com.au

SOURCE Antisense Therapeutics Limited

 


Leave a comment

This site uses Akismet to reduce spam. Learn how your comment data is processed.

DR ANTHONY CRASTO

Follow New Drug Approvals on WordPress.com

Enter your email address to follow this blog and receive notifications of new posts by email.

Join 37.9K other subscribers
DR ANTHONY MELVIN CRASTO Ph.D

DR ANTHONY MELVIN CRASTO Ph.D

DR ANTHONY MELVIN CRASTO, Born in Mumbai in 1964 and graduated from Mumbai University, Completed his Ph.D from ICT, 1991,Matunga, Mumbai, India, in Organic Chemistry, The thesis topic was Synthesis of Novel Pyrethroid Analogues, Currently he is working with AFRICURE PHARMA, ROW2TECH, NIPER-G, Department of Pharmaceuticals, Ministry of Chemicals and Fertilizers, Govt. of India as ADVISOR, earlier assignment was with GLENMARK LIFE SCIENCES LTD, as CONSUlTANT, Retired from GLENMARK in Jan2022 Research Centre as Principal Scientist, Process Research (bulk actives) at Mahape, Navi Mumbai, India. Total Industry exp 32 plus yrs, Prior to joining Glenmark, he has worked with major multinationals like Hoechst Marion Roussel, now Sanofi, Searle India Ltd, now RPG lifesciences, etc. He has worked with notable scientists like Dr K Nagarajan, Dr Ralph Stapel, Prof S Seshadri, etc, He did custom synthesis for major multinationals in his career like BASF, Novartis, Sanofi, etc., He has worked in Discovery, Natural products, Bulk drugs, Generics, Intermediates, Fine chemicals, Neutraceuticals, GMP, Scaleups, etc, he is now helping millions, has 9 million plus hits on Google on all Organic chemistry websites. His friends call him Open superstar worlddrugtracker. His New Drug Approvals, Green Chemistry International, All about drugs, Eurekamoments, Organic spectroscopy international, etc in organic chemistry are some most read blogs He has hands on experience in initiation and developing novel routes for drug molecules and implementation them on commercial scale over a 32 PLUS year tenure till date Feb 2023, Around 35 plus products in his career. He has good knowledge of IPM, GMP, Regulatory aspects, he has several International patents published worldwide . He has good proficiency in Technology transfer, Spectroscopy, Stereochemistry, Synthesis, Polymorphism etc., He suffered a paralytic stroke/ Acute Transverse mylitis in Dec 2007 and is 90 %Paralysed, He is bound to a wheelchair, this seems to have injected feul in him to help chemists all around the world, he is more active than before and is pushing boundaries, He has 100 million plus hits on Google, 2.5 lakh plus connections on all networking sites, 100 Lakh plus views on dozen plus blogs, 227 countries, 7 continents, He makes himself available to all, contact him on +91 9323115463, email amcrasto@gmail.com, Twitter, @amcrasto , He lives and will die for his family, 90% paralysis cannot kill his soul., Notably he has 38 lakh plus views on New Drug Approvals Blog in 227 countries......https://newdrugapprovals.wordpress.com/ , He appreciates the help he gets from one and all, Friends, Family, Glenmark, Readers, Wellwishers, Doctors, Drug authorities, His Contacts, Physiotherapist, etc He has total of 32 International and Indian awards

View Full Profile →

bloglovin

Follow my blog with Bloglovin The title of your home page You could put your verification ID in a comment Or, in its own meta tag Or, as one of your keywords Your content is here. The verification ID will NOT be detected if you put it here.