New Drug Approvals

Home » 2014 » April » 03

Daily Archives: April 3, 2014

DRUG APPROVALS BY DR ANTHONY MELVIN CRASTO .....FOR BLOG HOME CLICK HERE

Blog Stats

  • 5,005,350 hits

Flag and hits

Flag Counter

Enter your email address to follow this blog and receive notifications of new posts by email.

Join 37.8K other subscribers
Follow New Drug Approvals on WordPress.com

Archives

Categories

Recent Posts

Flag Counter

ORGANIC SPECTROSCOPY

Read all about Organic Spectroscopy on ORGANIC SPECTROSCOPY INTERNATIONAL 

Enter your email address to follow this blog and receive notifications of new posts by email.

Join 37.8K other subscribers
DR ANTHONY MELVIN CRASTO Ph.D

DR ANTHONY MELVIN CRASTO Ph.D

DR ANTHONY MELVIN CRASTO, Born in Mumbai in 1964 and graduated from Mumbai University, Completed his Ph.D from ICT, 1991,Matunga, Mumbai, India, in Organic Chemistry, The thesis topic was Synthesis of Novel Pyrethroid Analogues, Currently he is working with AFRICURE PHARMA, ROW2TECH, NIPER-G, Department of Pharmaceuticals, Ministry of Chemicals and Fertilizers, Govt. of India as ADVISOR, earlier assignment was with GLENMARK LIFE SCIENCES LTD, as CONSUlTANT, Retired from GLENMARK in Jan2022 Research Centre as Principal Scientist, Process Research (bulk actives) at Mahape, Navi Mumbai, India. Total Industry exp 32 plus yrs, Prior to joining Glenmark, he has worked with major multinationals like Hoechst Marion Roussel, now Sanofi, Searle India Ltd, now RPG lifesciences, etc. He has worked with notable scientists like Dr K Nagarajan, Dr Ralph Stapel, Prof S Seshadri, etc, He did custom synthesis for major multinationals in his career like BASF, Novartis, Sanofi, etc., He has worked in Discovery, Natural products, Bulk drugs, Generics, Intermediates, Fine chemicals, Neutraceuticals, GMP, Scaleups, etc, he is now helping millions, has 9 million plus hits on Google on all Organic chemistry websites. His friends call him Open superstar worlddrugtracker. His New Drug Approvals, Green Chemistry International, All about drugs, Eurekamoments, Organic spectroscopy international, etc in organic chemistry are some most read blogs He has hands on experience in initiation and developing novel routes for drug molecules and implementation them on commercial scale over a 32 PLUS year tenure till date Feb 2023, Around 35 plus products in his career. He has good knowledge of IPM, GMP, Regulatory aspects, he has several International patents published worldwide . He has good proficiency in Technology transfer, Spectroscopy, Stereochemistry, Synthesis, Polymorphism etc., He suffered a paralytic stroke/ Acute Transverse mylitis in Dec 2007 and is 90 %Paralysed, He is bound to a wheelchair, this seems to have injected feul in him to help chemists all around the world, he is more active than before and is pushing boundaries, He has 100 million plus hits on Google, 2.5 lakh plus connections on all networking sites, 100 Lakh plus views on dozen plus blogs, 227 countries, 7 continents, He makes himself available to all, contact him on +91 9323115463, email amcrasto@gmail.com, Twitter, @amcrasto , He lives and will die for his family, 90% paralysis cannot kill his soul., Notably he has 38 lakh plus views on New Drug Approvals Blog in 227 countries......https://newdrugapprovals.wordpress.com/ , He appreciates the help he gets from one and all, Friends, Family, Glenmark, Readers, Wellwishers, Doctors, Drug authorities, His Contacts, Physiotherapist, etc He has total of 32 International and Indian awards

Verified Services

View Full Profile →

Archives

Categories

Flag Counter

Cenicriviroc in Phase 2 for HIV by Takeda/Tobira


 

Cenicriviroc.svg

Cenicriviroc

TAK-652; TBR-652

1-Benzazocine-5-carboxamide, 8-[4-(2-butoxyethoxy)phenyl]-1,2,3,4-tetrahydro-1-(2-methylpropyl)-N-[4-[[(1-propyl-1H-imidazol-5-yl)methyl]sulfinyl]phenyl]-, (5E)-

(-)-(S)-8-[4-(2-Butoxyethoxy)phenyl]-1-isobutyl-N-[4-(1-propyl-1H-imidazol-5-ylmethylsulfinyl)phenyl]-1,2,3,4-tetrahydro-1-benzazocine-5-carboxamide

(S)()-8-{4-[2-(Butoxy)ethoxy]phenyl}-1-isobutyl-N-(4-{[(1-propyl-1H-imidazol-5-yl)methyl]sulfinyl}phenyl)-1,2,3,4-tetrahydro-1-benzazocine-5-carboxamide methanesulfonate

497223-25-3 , Molecular Formula: C41H52N4O4S   Molecular Weight: 696.94098

497223-28-6 (mesylate) C41 H52 N4 O4 S . C H4 O3 S, 793.047

Cenicriviroc, Cenicriviroc (USAN/INN), TAK652, TBR652, , 497223-25-3, D09878

Cenicriviroc (TAK-652, TBR-652) is an experimental drug candidate for the treatment of HIV infection.[1] It is being developed by Takeda Pharmaceutical and Tobira Therapeutics.

TBR-652 (formerly TAK-652) is a highly potent and orally active CCR5 antagonist in phase II clinical trials at Takeda for the treatment of HIV infection. Tobira Therapeutics is evaluating the compound in preclinical studies for the treatment of rheumatoid arthritis.

TBR-652 binds CCR5 receptors to interfere with the entry of the HIV-1 virus into macrophages and activated T-cells by inhibiting fusion between viral and cellular membranes. This mechanism of action differs from currently used HIV treatments such as nucleoside reverse transcriptase inhibitors and protease inhibitors.

In 2007, Takeda entered into an agreement with Tobira pursuant to which Tobira obtained exclusive worldwide rights to develop, manufacture and commercialize TBR-652 for the treatment of HIV infection.

Cenicriviroc is an inhibitor of CCR2 and CCR5 receptors,[2] allowing it to function as an entry inhibitor which prevents the virus from entering into a human cell. Inhibition of CCR2 may have an anti-inflammatory effect.

A double-blind, randomized, placebo-controlled clinical study to assess the antiviral activity, safety, and tolerability of cenicriviroc was conducted in 2010. HIV-infected patients taking cenicriviroc had significant reductions in viral load, with the effect persisting up to two weeks after discontinuation of treatment.[3] Additional Phase II clinical trials are underway.[4]

Phase IIb data presented at the 20th Conference on Retroviruses and Opportunistic Infections (CROI) in March 2013 showed similar viral suppression rates of 76% for patients taking 100 mg cenicriviroc, 73% with 200 mg cenicriviroc, and 71% with efavirenz. Non-response rates were higher with cenicriviroc, however, largely due to greater drop-out of patients. A new tablet formulation with lower pill burden may improve adherence. Looking at immune and inflammatory biomarkers, levels of MCP-1 increased and soluble CD14 decreased in the cenicriviroc arms.[5]

Although HIV has been largely rendered a chronic infection, there remains a need for new drugs because of the virus’s propensity to develop resistance to the drugs used to keep it at bay.

Pfizer’s maraviroc was the first drug that acted on the cells to prevent viral entry by antagonising the CCR5 co-receptor. Several others have been investigated and have failed; another that is undergoing clinical trials is Takeda’s cenicriviroc, which has been licensed to Tobira Therapeutics. Unlike maraviroc, the new agent also acts at the CCR2 co-receptor, which is implicated in cardiovascular and metabolic diseases.

In a Phase I double blind, placebo controlled trial designed to study safety, efficacy and pharmacokinetics, treatment-experienced but CCR5 antagonist-naïve patients with HIV-1 were given doses of 25, 50, 75, 100 or 150mg of the drug, or placebo once a day for 10 days.2 The maximum median reductions in HIV-1 RNA values were 0.7, 1.6, 1.8 and 1.7 log10 copies/ml for the respective doses, with a median time to nadir of 10 to 11 days. The effect on CD-4 cell counts was negligible. There was also a significant reduction in levels of monocyte chemotactic protein 1, suggesting that CCR2 was also being blocked. The drug was both generally safe and well tolerated, and no patients withdrew from the trial due to adverse events.

In another Phase I trial, designed to look at pharmacokinetics and pharmacodynamics and carried out in a similar patient population, subjects were given the drug as oral monotherapy for 10 days, again in doses of 25, 50, 75, 100 and 150mg, or placebo.3 The drug was well absorbed into the systemic circulation, and the concentration levels declined slowly, with meant elimination half-lives of one to two days. Potent, dose-dependent reductions in viral load were seen, and again it was generally safe and well tolerated across all levels.

In June 2011, Tobira initiated a multi-centre, double blind, double dummy, 48-week comparative Phase IIb trial in 150 patients with HIV-1 infection. Subjects are being given 100 or 200mg once-daily doses of the drug to evaluate its efficacy, safety and tolerability.

PATENTS

WO  2003014105

WO 2003076411

WO 2005116013

WO 2007144720

WO 2011163389

US 20130079233

WO 2013167743

 

See also

ancriviroc (formerly known as SCH-C), vicroviroc which has the chemical name (4,6-dimethylprymidine-5-yl){4- [(3S)-4-{(1 R)-2-methoxy-1 -[4-(trifluoromethyl)phenyl]ethyl}-3-methylpiperazin-1 -yl]-4-methylpiperidin-1 – yljmethanone, PRO-140, apliviroc (formerly known as GW-873140, Ono-4128, AK-602), AMD-887, INC- B9471 , CMPD-167 which has the chemical name N-methyl-N-((1R,3S,4S)-3-[4-(3-benzyl-1-ethyl-1H- pyrazol-δ-yOpiperidin-i-ylmethylH-IS-fluorophenyllcyclopent-i-yll-D-valine), methyl1-endo-{8-[(3S)-3- (acetylamino)-3-(3-fluorophenyl)propyl]-8-azabicyclo[3.2.1]oct-3-yl}-2-methyl-4,5,6,7-tetrahydro-1 H- imidazo[4,5-c]pyridine-5-carboxylate, methyl 3-endo-{8-[(3S)-3-(acetamido)-3-(3-fluorophenyl)propyl]-8- azabicyclo[3.2.1]oct-3-yi}-2-methyl-4,5,6,7-tetrahydro-3H-imidazo[4,5-c]pyridine-5-carboxylate, ethyl 1- endo-{8-[(3S)-3-(acetylamino)-3-(3-fiuorophenyl)propyl]-8-azabicyclo[3.2.1]oct-3-yl}-2-methyl-4,5,6,7- tetrahydro-1 H-imidazo[4,5-c]pyridine-5-carboxylate and N-{(1S)-3-[3-endo-(5-lsobutyryl-2-methyl-4,5,6,7- tetrahydro-1H-imidazo[4,5-c]pyridin-1-yl)-8-azabicyclo[3.2.1]oct-8-yl]-1-(3-fluorophenyl)propyl}acetamide) and pharmaceutically acceptable salts, solvates or derivatives of the above. The last four compounds are disclosed in WO 03/084954 and WO 05/033107.

 

J. Med. Chem.200649 (6), pp 2037–2048
DOI: 10.1021/jm0509703

http://pubs.acs.org/doi/full/10.1021/jm0509703

 

 

Compound (S)-(−)-5b (TAK-652) also inhibited the replication of six macrophage-tropic (CCR5-using or R5) HIV-1 clinical isolates in peripheral blood mononuclear cells (PBMCs) (mean IC90 = 0.25 nM).

(S)()-8-{4-[2-(Butoxy)ethoxy]phenyl}-1-propyl-N-(4-{[(1-propyl-1H-imidazol-5-yl)methyl]sulfinyl}phenyl)-1,2,3,4-tetrahydro-1-benzazocine-5-carboxamide ((S)()-5a). The 1 N HCl (160 mL) was added to 1931 (35.68 g, 53.4 mmol), and the mixture was extracted with EtOAc. To the aqueous layer was added 25% aqueous K2CO3 (160 mL), and the mixture was extracted with a mixture of EtOAc and i-PrOH (4:1). The organic layer was washed with brine, dried over MgSO4, and concentrated in vacuo to give (S)-18. To a solution of 16a (18.0 g, 41.1 mmol) and DMF (0.5 mL) in THF (180 mL) was added thionyl chloride (SOCl2) (4.50 mL, 61.7 mmol) at room temperature. After being stirred at room temperature for 1.5 h, the reaction mixture was concentrated in vacuo. A solution of the residue in THF (200 mL) was added dropwise to a mixture of (S)-18 and triethylamine (Et3N) (35.0 mL, 251 mmol) in THF (150 mL) under ice cooling. After being stirred at room temperature for 4 h, water was added to the reaction mixture. The mixture was washed with 10% aqueous AcOH, saturated aqueous NaHCO3, and brine, dried over MgSO4, and concentrated in vacuo. The residue was purified by column chromatography on a NH silica gel (hexane/EtOAc = 1:5 → 1:8 → 1:9) to give 21.14 g (75%) of (S)-(−)-5a as a yellow amorphous powder, [α]D = 132.5° (C = 0.507%, EtOH). 1H NMR (300 MHz, CDCl3) δ 0.87−1.03 (9H, m), 1.34−1.49 (2H, m), 1.50−1.85 (8H, m), 2.55−2.65 (2H, m), 3.15−3.25 (2H, m), 3.52−3.58 (4H, m), 3.75−3.83 (4H. m), 4.02 (1H, d, J = 13.8 Hz), 4.08−4.17 (3H, m), 6.56 (1H, d, J = 1.0 Hz), 6.80 (1H, d, J = 8.8 Hz), 6.96 (2H, d, J = 8.8 Hz), 7.31−7.46 (7H, m), 7.55 (1H, s), 7.76 (2H, d, J = 8.8 Hz), 7.98 (1H, s). Anal. (C40H50N4O4S·0.25H2O) C, H, N.

 

(S)()-8-{4-[2-(Butoxy)ethoxy]phenyl}-1-isobutyl-N-(4-{[(1-propyl-1H-imidazol-5-yl)methyl]sulfinyl}phenyl)-1,2,3,4-tetrahydro-1-benzazocine-5-carboxamide methanesulfonate ((S)()-5b). The free base of (S)-(−)-5b was prepared in 80% yield from 16band 19 by a method similar to that described for (S)-(−)-5a. To a solution of the free base of (S)-(−)-5b (64.91 g, 93.1 mmol) in EtOAc (600 mL) was added dropwise a solution of methanesulfonic acid (8.95 g, 93.1 mmol) in EtOAc (160 mL) at room temperature. After being stirred at room temperature for 4 h, the crystals were collected by filtration and washed with EtOAc to give 69.09 g (94%) of (S)-(−)-5b as yellow crystals. The crystals (68.0 g) were purified by recrystallization from 2-butanone to give 58.9 g (85%) of (S)-(−)-5b as yellow crystals, mp 145.5−147.5 °C, [α]D = −191.2° (= 0.508%, EtOH). 1H NMR (300 MHz, DMSO-d6) δ 0.82−0.97 (12H, m), 1.29−1.39 (2H, m), 1.40−1.55 (4H, m), 1.65−1.85 (2H, m), 2.00−2.25 (1H, m), 2.29 (3H,s), 2.38−2.60 (2H, m), 3.10 (2H, d, J = 7.8 Hz), 3.30−3.60 (4H, m), 3.70 (2H, t, J = 4.8 Hz), 3.98 (2H, t,J = 6.6 Hz), 4.10 (2H, t, J = 4.8 Hz), 4.34 (1H, d, J = 15.0 Hz), 4.68 (1H, d, J = 15.0 Hz), 6.87 (1H, d, J = 8.7 Hz), 6.99 (2H, d, J = 8.7 Hz), 7.16 (1H, s), 7.42−7.60 (8H, m), 7.93 (2H, d, J = 8.7 Hz), 9.05 (1H, s), 10.18 (1H, s). Anal. (C42H56N4O7S2) C, H, N.

 

…………………

WO 2003014105 OR  US20090030032

http://www.google.st/patents/US20090030032?hl=pt-PT&cl=un

EXAMPLE 7 Preparation of Compounds 9 and 10

8-[4-(2-Butoxyethoxy)phenyl]-1-propyl-N-[4-[[[1-propyl-1H-imidazol-5-yl]methyl]sulfinyl]phenyl]-1,2,3,4-tetrahydro-1-benzazocin-5-carboxamide (317 mg) was resolved by using CHIRAKCEL OJ 50 mm ID×500 mL (hexane/ethanol) to give (−)-8-[4-(2-butoxyethoxy)phenyl]-1-propyl-N-[4-[[[1-propylimidazol-5-yl]methyl]sulfinyl]phenyl]-1,2,3,4-tetrahydro-1-benzoazocine-5-carboxamide (142 mg) (Compound 9) and (+)-8-[4-(2-butoxyethoxy)phenyl]-1-propyl-N-[4-[[[1-propylimidazol-5-yl]methyl]sulfinyl]phenyl]-1,2,3,4-tetrahydro-1-benzoazocine-5-carboxamide (143 mg) (Compound 10).

Compound 9

[α]D=−127.4° (C=0.533% in ethanol).

Compound 10

[α]D=+121.0° (C=0.437% in ethanol).

………………………….

WO 2003076411

http://www.google.st/patents/WO2003076411A1?cl=en

http://www.google.st/patents/US20050107606?hl=pt-PT&cl=en

Figure US20050107606A1-20050519-C00023

Example 21 (−)-8-[4-(2-Butoxyethoxy)phenyl]-1-isobutyl-N-(4-{[(1-propyl-1H-imidazol-5-yl)methyl]sulfinyl}phenyl)-1,2,3,4-tetrahydro-1-benzazocine-5-carboxamide

To a solution of 8-[4-(2-butoxyethoxy)phenyl]-1-isobutyl-1,2,3,4-tetrahydro-1-benzazocine-5-carboxylic acid (45 g) in tetrahydrofuran (135 ml) was added N,N-dimethylformamide (230 mg) and added dropwise thionyl chloride (12.45 g) at 10 to 15° C., and the resulting solution was stirred at the same temperature for 40 minutes to prepare an acid chloride.

Separately, to a solution of (−)-4-{[(1-propyl-1H-imidazol-5-yl)methyl]sulfinyl}phenylamine in tetrahydrofuran (270 ml) was added pyridine (27.59 g), the resulting mixture was adjusted to 5° C. or lower, and then thereto was added dropwise the acid chloride solution at 5° C. or less, and the resulting mixture was stirred at the same temperature for 2 hours. To the mixture were added water (270 ml) and 20% aqueous citric acid solution (180 ml), tetrahydrofuran was distilled off under reduced pressure and the residue was extracted with ethyl acetate. The extract was sequentially washed with water, saturated sodium bicarbonate solution and water, and then the solvent was distilled off. To the residue was added ethyl acetate (360 ml), added heptane (360 ml) at 40° C. and added seed crystals of (−)-8-[4-(2-butoxyethoxy)phenyl]-1-isobutyl-N-(4-{[(1-propyl-1H-imidazol-5-yl)methyl]sulfinyl}phenyl)-1,2,3,4-tetrahydro-1-benzazocine-5-carboxamide (10 mg), and the mixture was stirred at 25° C. for 2 hours and stirred at 5° C. for 1 hour. The precipitated crystals were collected by filtration to obtain 63.97 g (yield: 92.1%) of the title compound. Melting point: 120-122° C.

Elemental analysis value: in terms of C41H52N4O4S

Calcd. value: C, 70.66; H, 7.52; N, 8.04.

Analytical value: C, 70.42; H, 7.52; N, 8.01

Industrial Applicability

According to the present invention, an optically active sulfoxide derivative having CCR5 antagonism or an intermediate compound thereof can be prepared without causing side reactions such as racemization and Pummerer rearrangement. In particular, Process 7 is industrially advantageous since it is possible to prepare an optically active Compound (II) by asymmetric oxidization in the presence of an optically active acid.

 

 

Example 20 (−)-8-[4-(2-Butoxyethoxy)phenyl]-1-propyl-N-(4-{[(1-propyl-1H-imidazol-5-yl)methyl]sulfinyl}phenyl)-1,2,3,4-tetrahydro-1-benzazocine-5-carboxamide.methanesulfonate

According to the same method as that described in Example 15, the title compound was produced from 8-[4-(2-butoxyethoxy)phenyl]-1-propyl-1,2,3,4-tetrahydro-1-benzazocine-5-carboxylic acid and (−)-4-{[(1-propyl-1H-imidazol-5-yl)methyl]sulfinyl}phenylamine.

1H-NMR (CDCl3, δ, 300 MHz) 0.88-1.01 (9H, m), 1.37-1.42 (2H, m), 1.57-1.80 (8H, m), 2.63 (2H, br), 2.77 (3H, s), 3.27 (2H, br), 3.51-3.57 (4H, m), 3.77-3.86 (4H, m), 3.90-4.05 (1H, m), 4.14 (2H, t, J=4.6 Hz), 4.25 (1H, d, J=14.6 Hz), 6.73 (1H, s), 6.84 (1H, d, J=8.7 Hz), 6.93 (2H, d, J=8.8 Hz), 7.21 (2H, d, J=8.7 Hz), 7.40-7.48 (4H, m), 7.61 (1H, s), 7.89 (2H, d, J=8.7 Hz), 8.65 (1H, s), 9.27 (1H, br)

Elemental analysis value: in terms of C41H54N4O7S2

Calcd. value: C, 63.21; H, 6.99; N, 7.19; S, 8.23.

Analytical value: C, 63.00; H, 7.09; N, 7.41; S, 8.25

 

Example 15 (−)-8-[4-(2-Butoxyethoxy)phenyl]-1-isobutyl-N-(4-{[(1-propyl-1H-imidazol-5-yl)methyl]sulfinyl}phenyl)-1,2,3,4-tetrahydro-1-benzazocine-5-carboxamide.methanesulfonate

8-[4-(2-Butoxyethoxy)phenyl]-1-isobutyl-1,2,3,4-tetrahydro-1-benzazocine-5-carboxylic acid (986 mg) was dissolved in tetrahydrofuran (3 ml) and thereto was added N,N-dimethylformamide (one drop). Subsequently, to the resulting solution was added dropwise oxalyl chloride (0.2 ml, 2.29 mmol) under ice-cooling and the mixture was stirred for 80 minutes under ice-cooling to prepare an acid chloride.

Separately, (−)-4-{[(1-propyl-1H-imidazol-5-yl)methyl]sulfinyl}phenylamine (689 mg) was added to tetrahydrofuran (7 ml) and the resulting solution was cooled to 5° C. To the solution was added dropwise pyridine (0.62 ml) and added dropwise the acid chloride solution at 3 to 5° C., and the mixture was stirred for 2 hours under ice-cooling. To the mixture was added water (20 ml) at 10° C. or lower and the mixture was extracted with ethyl acetate. The organic layer was sequentially washed with water, saturated sodium bicarbonate solution and water, and concentrated under reduced pressure. Thereto was added toluene and the mixture was concentrated under reduced pressure. Thereto was added acetonitrile and the mixture was concentrated under reduced pressure. The residue was dissolved in acetonitrile (7 ml) and acetone (7 ml), thereto was added dropwise methanesulfonic acid (209 mg), and added seed crystals and the mixture was stirred at room temperature for 100 minutes. Subsequently, to the mixture was added acetone-acetonitrile (1:1, 5 ml). After stirring at room temperature overnight, the mixture was stirred for 2.5 hours under ice-cooling. The precipitated crystals were collected by filtration and washed with the ice-cooled acetone (9 ml). The crystals were dried at 40° C. under reduced pressure to obtain 1.51 g (yield: 87%) of the title compound as yellow crystals.

1H-NMR (300 MHz, DMSO-d6, δ): 0.78-0.96 (12H, m), 1.25-1.40 (2H, m), 1.41-1.51 (4H, m), 1.65-1.85 (2H, m), 2.05-2.15 (1H, m), 2.30 (3H, s), 2.35-2.50 (2H, m), 3.05-3.15 (2H, m), 3.30-3.55 (4H, m), 3.65-3.70 (2H, m), 3.90-4.05 (2H, m), 4.05-4.10 (2H, m), 4.30 (1H, d, J=14.73 Hz), 4.65 (1H, d, J=14.73 Hz), 6.85 (1H, d, J=8.97 Hz), 6.97 (1H, d, J=8.79 Hz), 7.17 (1H, s), 7.35-7.75 (6H, m), 7.92 (2H, d, J=8.79 Hz), 9.08 (1H, s), 10.15 (1H, s).

Elemental analysis value: in terms of C41H52N4O4S.CH4SO3

Calcd. value: C, 63.61; H, 7.12; N, 7.06; S, 8.09.

Found value: C, 63.65; H, 7.23; N, 7.05; S, 8.08.

………………………….

 

 

 

References

  1.  Klibanov, Olga M.; Williams, Shannon H.; Iler, Cameron A (2010). “Cenicriviroc, an orally active CCR5 antagonist for the potential treatment of HIV infection”. Current Opinion in Investigational Drugs 11 (8): 940–950. PMID 20721836.
  2.  Baba, Masanori; Takashima, Katsunori; Miyake, Hiroshi; Kanzaki, Naoyuki; Teshima, Koichiro; Wang, Xin; Shiraishi, Mitsuru; Iizawa, Yuji (2005). “TAK-652 inhibits CCR5-mediated human immunodeficiency virus type 1 infection in vitro and has favorable pharmacokinetics in humans”Antimicrobial Agents and Chemotherapy 49 (11): 4584–4591. doi:10.1128/AAC.49.11.4584-4591.2005PMC 1280155PMID 16251299.
  3.  C. Reviriego (2011). Drugs of the Future 36 (7): 511–517. doi:10.1358/dof.2011.36.7.1622066.
  4.  “Tobira Therapeutics Initiates Phase 2b Trial of Cenicriviroc”. The Body. July 5, 2011.
  5.  CROI 2013: CCR5/CCR2 Inhibitor Cenicriviroc Has Both Anti-HIV and Anti-inflammatory Effects. Highleyman, Liz. HIVandHepatitis.com. 7 March 2013.
11-26-2012
Chemokine receptor antagonists.
Journal of medicinal chemistry
6-1-2011
Safety, efficacy, and pharmacokinetics of TBR-652, a CCR5/CCR2 antagonist, in HIV-1-infected, treatment-experienced, CCR5 antagonist-naive subjects.
Journal of acquired immune deficiency syndromes (1999)
8-1-2010
Cenicriviroc, an orally active CCR5 antagonist for the potential treatment of HIV infection.
Current opinion in investigational drugs (London, England : 2000)
3-1-2009
The relative activity of “function sparing” HIV-1 entry inhibitors on viral entry and CCR5 internalization: is allosteric functional selectivity a valuable therapeutic property?
Molecular pharmacology
2-1-2007
Isolation and characterization of human immunodeficiency virus type 1 resistant to the small-molecule CCR5 antagonist TAK-652.
Antimicrobial agents and chemotherapy
9-10-2006
[Progress in AIDS therapy].
Nihon Naika Gakkai zasshi. The Journal of the Japanese Society of Internal Medicine
3-23-2006
Highly potent and orally active CCR5 antagonists as anti-HIV-1 agents: synthesis and biological activities of 1-benzazocine derivatives containing a sulfoxide moiety.
Journal of medicinal chemistry
11-1-2005
TAK-652 inhibits CCR5-mediated human immunodeficiency virus type 1 infection in vitro and has favorable pharmacokinetics in humans.
Antimicrobial agents and chemotherapy
1-27-2005
Stereoselective synthesis of [L-Arg-L/D-3-(2-naphthyl)alanine]-type (E)-alkene dipeptide isosteres and its application to the synthesis and biological evaluation of pseudopeptide analogues of the CXCR4 antagonist FC131.
Journal of medicinal chemistry
1-1-2005
TAK-652, a novel CCR5 inhibitor, has favourable drug interactions with other antiretrovirals in vitro.
Antiviral therapy

 

 

 

 

 

 

 

 

 

 

 

 

 

……………….

Chemical structures of selected small molecule CCR5 inhibitors. A. Maraviroc (MVC, Selzentry), B. Vicriviroc (VCV), C. Cenicriviroc (TBR-652), D. PF-232798.

http://www.intechopen.com/books/immunodeficiency/chemokine-receptors-as-therapeutic-targets-in-hiv-infection

 

 

ACH-702 the isothiazoloquinolone in preclinical from Achillion Pharmaceuticals (USA)


Antibiotics 02 00500 i009

ACH-702

7-[3(R)-(2-Aminopropan-2-yl)pyrrolidin-1-yl]-9-cyclopropyl-6-fluoro-8-methoxy-2,3,4,9-tetrahydroisothiazolo[5,4-b]quinoline-3,4-dione

(7^-7-[3-(1-AMrNO-I-METHYLETHYL)PYRROLiDiN-I-YL]-P-CYCLOPROPYL-6-FLUORO-8-METHOXY-PH-ISOTHIAZOLO[5,4-B]QUINOLINE-3,4-DIONE

(R)- 7-[3-(l-amino-l-methyl-ethyl)-pyrrolidin-l-yl]-9-cyclopropyl-6-fluoro-8-methoxy- 9H-isothiazolo[5, 4-b] -quinoline-3, 4-dione

922491-46-1 free base

922491-09-6 (hydrochloride)468.973, C21 H25 F N4 O3 S . Cl H

ACH-0139586
ACH-702

Achillion Pharmaceuticals (USA)

pre clinical

Achillion Pharmaceuticals is working on the discovery of compounds in a new subclass of quinolones, the isothiazoloquinolones. The most advanced compound is ACH-702, which is at the pre-clinical stage of development [1-3].

Fig. 1.ACH 702

 

The utility of isothiazoloquinolines as pharmaceutical agents has been discussed in the literature. For example, Pinol, et al discussed the use of isothiazoloquinolines as medical bactericides in US Patent 5,087,621, including

 

Figure imgf000004_0001

The Proctor & Gamble Company discussed antimicrobial quinolones including the following compound:

 

Figure imgf000004_0002

in published application no. US 2003008894.

The use of isothiazoloquinoline compounds as TNF production inhibitors has also been discussed, for example by Sankyo Co., Ltd. in JPl 010149, which includes the following compound

 

Figure imgf000004_0003

Bayer Aktiengesellschaft has discussed bicycle[3.3.0]oct-7-yl containing compounds useful for treating H. pylori infections in WO 98/26768, including isothiazoloquinolines, having the general structure shown below in which Y may be sulfur joined to the carboxamide group to form a 5-membered ring

 

Figure imgf000005_0001

Otsuka Pharmaceutical Co., Ltd. has discussed the use of isothiazoloquinolines as antibacterial agents in JP 01193275, including the following carbamate-containing compound

 

Figure imgf000005_0002

Abbott Laboratories has discussed the use of isothiazoloquinolines as antineoplastic agents in US Patent No. 5,071,848 and has discussed the use of tricyclic quinolones as antibacterial agents in US 4,767,762. The Abbott compounds have hydrogen, halogen, or lower alkyl as substituents at the 6- and 8- positions of the isothiazoloquinoline core.

………………

Synthesis

WO2008021491A2

http://www.google.com/patents/WO2008021491A2?cl=en

EXAMPLE 1. SYNTHESIS OF (7^-7-[3-(1-AMrNO-I-METHYLETHYL)PYRROLiDiN-I-YL]-P-

CYCLOPROPYL-6-FLUORO-8-METHOXY-PH-ISOTHIAZOLO[5,4-B]QUINOLINE-3,4-DIONE (5). Step 1. Ethyl l-cyclopropyl-6, 7-difluoro-2-methanesulfonyl-8-methoxy-4-oxo-l,4-dihydro- quinoline-3-carboxylate (6)

Oxonβ®

MeOHZH2O

Figure imgf000027_0002
1
Figure imgf000027_0001

6

Water (180 mL), followed by Oxone® (Dupont Specialty Chemicals) (170 g, 277 mmol), is added to a suspension of 1 in MeOH (510 mL). The reaction mixture is heated with stirring at 55-60 0C for 3 h. The reaction mixture is cooled to room temperature, diluted with water (40 mL), and stirred at 5 0C (ice bath) for 30 min. The resulting crystals are collected by filtration, washed with water (2 x 100 mL), and dried to afford 6 (13.8 g). This material was used in the next step without further purification, mp 177-178 0C. 1H NMR (DMF-^7): J0.62 (m, IH), 1.11 (m, 2H), 1.29 (m, IH), 1.32 (t, JH-H = 7.0 Hz, 3H), 3.76 (s, 3H), 4.18 (m, IH), 4.21 (d, JH-F = 2.0 Hz, 3H), 4.33 (q, JHH = 7.0 Hz, 2H), 7.64 (dd, JH-F = 10.0 Hz, 8.5 Hz, IH). Step 2 (R)- 7-[3-(l-amino-l-methyl-ethyl)-pyrrolidin-yl]-l-cyclopropyl-6-fluoro-2- methanesulfonyl-8-methoxy-4-oxo-l , 4-dihydro-quinoline-3-carboxylic acid ethyl ester (7)

 

Figure imgf000027_0003

10                                                                                  6                                                                                            7

A mixture containing compound (6) (3.88 g, 9.67 mmol), compound 10 (1.64 g, 12.8 mmol), anhydrous DIEA (5.05 g, 39.1 mmol, dried over 4A sieves), and anhydrous DMF (40 mL) is heated at 70 0C under an atmosphere of argon gas. After heating for 4.5 h (LC-MS analysis shows ~7% compound (6) remained), the reaction mixture is cooled to room temperature, diluted with EtOAc (200 mL), and washed with water (100 mL). The aqueous layer is extracted with EtOAc (100 mL), and the combined organic layers are washed with a saturated aqueous solution of sodium bicarbonate (100 mL). The organic layer is diluted with water (100 mL) and treated with an aqueous solution of HCl (4 N) until the aqueous layer is acidic (pH 2—3 after shaking the mixture vigorously). The organic layer is separated, and this process is repeated. The combined aqueous layers are diluted with EtOAc (100 mL) and treated with an aqueous solution of sodium hydroxide (6 N) until the aqueous layer is basic (pH ~8 after shaking the mixture vigorously). The aqueous layer is separated, and this process is repeated. The combined organic layers are dried over magnesium sulfate, filtered, and concentrated under reduced pressure giving an orange solid (3.27 g of an~80:20 mixture of compound (7) and impurity B). This solid is recrystallized from hot EtOAc (~60 mL) furnishing 2.18 g (44% yield) of pure compound 7 as a bright yellow solid. LC-MS mlz calcd for C24H32FN3O6S 509 ([M+]); found 510 ([M + H]+).

This reaction should not be allowed to proceed for more than a few hours (not overnight) as prolonged reaction time can lead to the formation of more side products. The product should be —95% pure (based on HPLC), with only a trace amount of impurity B. Step 3. (R)-7-[3-(l-amino-l-methyl-ethyl)-pyrrolidin-yl]-l-cyclopropyl-6-fluoro-2-mercapto-8- methoxy-4-oxo-l,4-dihydro-quinoline-3-carboxylic acid ethyl ester (8)

 

Figure imgf000028_0001

7                                                                                                                                                                                          8

Compound 7 (1.04 g, 2.04 mmol) is partially dissolved in DME (40 mL) under an atmosphere of argon. Sodium hydrosulfide hydrate (Aldrich, 72.6% by titration, 465 mg, 6.02 mmol) in water (3.0 mL) is added to this solution. The resulting mixture is sparged slowly with argon for 30 min.

The progress of the reaction is monitored by HPLC-MS, and judged to be complete (<2% of 7 remains) after 11.5 h. Excess sodium hydrosulfide is quenched upon addition of aq HCl (4.5 mL, 4 N).

The resulting orange solution (pH ~2) is sparged with argon (30 min) to remove the generated hydrogen sulfide. Step. 4 (R)- 7-[3-(l-amino-l-methyl-ethyl)-pyrrolidin-l-yl]-9-cyclopropyl-6-fluoro-8-methoxy- 9H-isothiazolo[5, 4-b] -quinoline-3, 4-dione (5)

 

Figure imgf000029_0001
5= ACH 702

A solution of potassium carbonate (4.26 g, 30.8 mmol) in water (25 mL) is next added to this solution to give a clear yellow solution (pH 9-10). The clear yellow solution is then sparged with argon for ~5 min. Finally, hydroxylamine-0-sulfonic acid (0.93 g, 8.2 mmol) is added portionwise as a solid, with immediate evolution of gas and formation of the product as a yellow precipitate. After stirring for 16 h, the reaction mixture (pH 10.2) is acidified with aq HCl to pH 8.3 (the approximate isoelectric point of 5) causing additional product to precipitate from solution. The reaction mixture is concentrated under reduced pressure (final volume -40 mL). The yellow precipitate is collected by centrifugation, washed with water (3 x 40 mL, with sonication), and lyophilized to give 0.80 g of 5.

……………………..

WO2007014308A1

 

http://www.google.com/patents/WO2007014308A1?cl=en

 

EXAMPLE 5. SYNTHESIS OF I-METHYL-I-PYRROLIDIN-3-YL ETHYLAMINE (5)

1 -Methyl- l-pyrrolidin-3-yl-ethylamine is prepared in accordance with the synthetic scheme below.

 

Figure imgf000071_0001

N O

 

Figure imgf000071_0002

5 P

Step 1. Synthesis of (S)-l-benzylpyrrolidin-3-yl methanesulfonate (N).

Methanesulfonyl chloride (15 mL, 0.19 mol) is added to a cooled (0 0C) solution of toluene (300 mL) containing (5)-l-benzylpyrrolidin-3-ol (24.5 g, 0.14 mol) and triethylamine (80 mL, 0.57 mol). The resulting mixture is stirred at 0 °C for 15 min, and allowed to warm to room temperature with stirring for 2h. The mixture is quenched with a 5% aqueous solution of sodium bicarbonate (250 mL). The organic layer is washed with a 5% aqueous solution of sodium bicarbonate (2 x 250 mL), washed with water (I x 250 mL), dried over magnesium sulfate, and concentrated under reduced pressure to give N (35.1 g, 99 %) as an orange oil. 1H NMR (300 MHz, CDCl3): £2.07 (m, IH), 2.30 (m, IH), 2.49 (m, IH), 2.75-2.90 (m, 3H), 2.98 (s, 3H), 3.61 (d, J= 13.0 Hz, IH), 3.68 (d, J= 13.0 Hz, IH), 5.18 (m, IH), 7.15-7.30 (m, 5H). LCMS mlz calcd for C12H17NO3S 255 ([M+]); found 256 ([M + H]+, 100%), 160 (40%). Steps 2 and 3. Syntheses of(R)-l-benzylpyrrolidine-3~carbonitrile (O) and 2-((R)-I- benzylpyrrolidin-3-yl)propan-2-amine (P).

The syntheses of O and P are described previously by Fedij et al. (Fedij, V.; Lenoir, E. A., Ill; Suto, M. J.; Zeller, J. R.; Wemple, J. Tetrahedron: Asymmetry 1994, J, 1131- 1134). Step 4. Synthesis ofl-((R)-Methyl~l-pyrrolidin-3-yl)-ethylamine (5).

A mixture containing P (7.4 g), 20% palladium hydroxide on carbon (7.5 g), and ethanol (75 niL) is stirred under an atmosphere of hydrogen gas (50 psi) at 45 °C for 24 h. The mixture is filtered and the filtrate is concentrated under reduced pressure to give 5 (4.1 g, 95 %) as a yellow oil. This material is stored under an atmosphere of argon gas. 1H NMR (300 MHz, CDCl3): J1.09 (s, 6H), 1.51 (m, IH), 1.64 (br s, 3H), 1.81 (m, IH), 2.06 (apparent pentet, J= 8.5 Hz, IH), 2.69 (dd, J= 11.0 Hz, J= 8.5 Hz, IH), 2.94 (m, 2H), 3.00 (dd, J= 11.0 Hz, J= 8.5 Hz, IH). LCMS mlz calcd for C7H16N2 128 ([M+]); found 129 ([M + H]+, 60%), 112 (100%).

 

 

EXAMPLE 6. GENERAL METHOD FOR THE FINAL AMINE-COUPLING STEP: SYNTHESIS OF 7-((R)-3-

(2-AMINOPROPAN-2-YL)PYRROLIDIN- 1 -YL)-9-CYCLOPROPYL-6-FLUORO-8- METHOXYISOTHIAZOLO[5,4-B]QUINOLINE-3 ,4(2H,9H)-DIONE HYDROCHLORIDE

[0261 ] 7-((R)-3-(2-Aminopropan-2-yl)pyrrolidin- 1 -yl)-9-cyclopropyl-6-fluoro-8- methoxyisothiazolo[5,4-b]quinoline-3,4(2H,9H)-dione hydrochloride is prepared in accordance with the synthetic scheme below.

 

Figure imgf000072_0001

Synthesis ofJ-ffRJS-^-aminopropan^-ylJpyrrolidin-l-ylJ-P-cyclopropyl-o-fluoro-S- methoxyisothiazolofS, 4-bJguinoline-3,4(2H, 9H)-dione hydrochloride (6).

Under an atmosphere of argon, a reaction vessel is charged with 5 (206.0 mg, 1.6 mmol), 3 (328.6 mg, 1.0 mmol), dimethyl sulfoxide (4.5 mL), and ΛζN-diisopropylethylamine (750 μL, 4.3 mmol). The resulting mixture is irradiated with microwaves (CEM Discover) at 125 0C for 1 h (conventional heating may also be used — 115 °C in an oil bath for 14 h), allowed to cool, and evaporated to dryness under reduced pressure (-70 °C/2-3 mm Hg). The oily residue is triturated with ethyl acetate (15 mL) and the resulting powder is collected by centrifugation. This solid is purified using preparative HPLC to give the desired product. Preparative HPLC is performed using a YMC Pack Pro C18 150 x 30.0 mm 5//m column coupled to a YMC Pack Pro 50 x 20 mm 5/an column with an isocratic elution of 0.37 min at 95:5 H2OiCHsCN containing 0.1% TFA followed by a 15.94 min linear gradient elution from 95:5 to 25:75, followed by a 0.69 min linear gradient from 25:75 to 5:95 at a flow rate of 30.0 mL/min with UV detection at 254. The crude material is loaded as a solution containing acetic acid (~2 mL), methanol (~1 mL), and water (~1 mL). The purified product is isolated as the TFA salt and is converted to the corresponding hydrochloride salt by addition of a solution of hydrogen chloride (~1.25 M in methanol) followed by evaporation; this process is repeated twice to give a yellow solid. Purity by HPLC: >99%; tR = 10.08 min. 1H NMR (300 MHz, TFA-d): δ 1.28 (m, 2H), 1.53 (m, 2H), 1.66 (s, 6H), 2.43 (m, IH), 2.57 (m, IH), 3.35 (m, IH), 3.97 (s, 3H), 4.01-4.38 (m, 5H), 8.17 (d, J= 12.0 Hz, IH, aromatic). 19F(1H) (282 MHz, TFA-J): δ-\ 18.0 (s). 13C(1H) (75 MHz, TFA-d): £13.5, 13.9, 25.0, 25.1, 29.1, 39.7, 49.6, 59.4 (br, W1/2 « 14 Hz), 59.8 (br, W1/2 « 14 Hz), 60.0, 66.8, 106.0, 112.1 (dJc_F = 23.0 Hz), 137.5 (br m, W1/2 « 24 Hz), 138.4, 144.8 (br, W1/2 » 10 Hz), 155.3 (dJc_F = 255.0 Hz), 169.8, 170.1, 171.5 (br, W1/2 « 9 Hz). LCMS mlz calcd for C21H25FN4O3S 432 ([M+]); found 433 ([M + H]+). Anal. Calcd for C21H25FN4O3S-l.5HCM.5H2O: C, 49.05; H, 5.78; N, 10.90; Cl, 10.34. Found: C, 49.30; H, 5.60; N, 10.83; Cl, 10.00.

 

EXAMPLE 3. SYNTHESIS OF 9-CYCLθPRθPYL-6,7-DiFLUθRθ-8-METHθχγ-9H-isoτHiAzθLθ[5,4- 5]QUlNOLlNE-3,4-DIONE (Compound 3).

9-Cyclopropyl-6,7-difluoro-8-methoxy-9H-isothiazolo[5,4-&]quinoline-3,4-dione (3) is prepared in accordance with the synthetic scheme below.

 

Figure imgf000062_0001

Step 1. Synthesis of 2,4, 5-trifluoro-3-methoxybenzoyl chloride (A)

A mixture of 2,4,5-trifluoro-3-methoxybenzoic acid (154 mg, 0.75 mmol) and thionyl chloride (8 mL) is refluxed for 4 h. Excess thionyl chloride is removed in vacuo, and the remaining residue is used directly in the next synthetic step. Step 2. Synthesis of (Z)-ethyl 3-hydroxy-3-(2,4,5-trifluoro-3-methoxyphenyl)aaγlate (B).

Compound B is prepared using the general method of Wierenga and Skulnick (Wierenga, W.; Skulnick, H. I. J. Org. Chein. (1979) 44: 310-311). H-Butyllithium (1.6 M in hexanes) is added to a cooled (-78 °C) solution of tetrahydrofliran (10 mL) containing ethyl hydrogen malonate (180 juL, 1.50 mmol) and 2,2′-bipyridyl (~1 mg as indicator). The temperature of the reaction mixture is allowed to rise to ca. -5 0C during the addition of n- butyllithium. Sufficient n-butyllithium (2.8 mL, 4.48 mmol) is added until a pink color persists at -5 0C for 5-10 min. A solution of 2,4,5-trifluoro-3-methoxybenzoyl chloride (0.75 mmol, vide supra) in tetrahydrofuran (~3 mL) is added in one portion to the reaction mixture that had been recooled to -78 0C. The resulting mixture is allowed to warm to room temperature, diluted with ethyl acetate (50 mL), and quenched with a 1 M aqueous solution of hydrochloric acid. The organic layer is washed with a 5% aqueous solution of sodium bicarbonate (2 x 30 mL), followed by brine (2 x 50 mL), dried over sodium sulfate, and evaporated under reduced pressure to give the crude product. This material is purified by flash column chromatography (eluting with 20% v/v ethyl acetate in hexanes) to give pure B as a white solid. 1H NMR (300 MHz, CDCl3): (enol, predominant tautomer, >90%) δ 1.32 (t, JHH = 7.0 Hz, 3H, CO2CH2CH3), 4.02 (apparent t, JHF = 1.0 Hz, 3H, OCH3), 4.25 (q, JHH = 7.0 Hz, 2H, CO2CH2CH3), 5.79 (s, IH, CH3C(OH)=CH- CO2CH2CH3), 7.39 (ddd, JH_F= 11.0 Hz, 8.5 Hz, 6.5 Hz, IH, aromatic), 12.68 (s, IH, OH). 19F(1H) NMR (282 MHz, CDCl3): <5-146.8 (dd, JF_F = 21.5 Hz, 10.5 Hz, IF), -140.2 (dd, JF_F = 21.5 Hz, 13.5 Hz, IF), -131.3 (dd, JF_F = 13.5 Hz, 10.5 Hz, IF).

Step 3. Synthesis ofζEyethy^-^ZJ-N-cyclopropy^methylthioJcarbonoimidoylJS-hydroxyS- (2, 4, 5-trifluoro-3-methoxyphenyl)acrylate (C)

Sodium hydride (60% in mineral oil, 31 mg, 0.78 mmol) is added portionwise to a cooled (0 °C) solution containing B (200 mg, 0.73 mmol), cyclopropyl isothiocyanate (120 /JL, 1.2 mmol), and dimethylformamide (2 mL). The resulting mixture is allowed to warm to room temperature with stirring overnight (18 h). Methyl iodide (80 juL, 1.2 mmol) is added to the resulting solution and stirred for an additional 4 h (until TLC indicated the complete consumption of B). The reaction mixture is diluted with ethyl acetate (100 mL) and quenched by addition of a saturated aqueous solution of ammonium chloride (30 mL). The organic layer is washed with brine (4 x 30 mL), dried over sodium sulfate, and evaporated under reduced pressure to give the crude product. This material is purified by flash column chromatography (eluting with 40% v/v ethyl acetate in hexanes) to give C as a yellow oil. 1H NMR (300 MHz, CDCl3): (50.86 (m, 2H, cyclopropyl CH2), 0.97 (m, 5H), 2.52 (s, 3H, SCH3), 3.00 (m, IH, cyclopropyl CH), 3.96 (q, JHH = 7.0 Hz, 2H, CO2CH2CH3), 4.02 (apparent t, JHF = 1.0 Hz, 3H, OCH3), 6.96 (m, IH, aromatic), 11.71 (s, IH). 19F(1H) NMR (282 MHz, CDCl3): £-149.9 (br, IF), -141.4 (br, IF), -135.7 (br, IF).

Step 4. Synthesis of ethyl l-cyclopropyl-6,7-difluoro-8-methoxy-2-(methylthio)-4-oxo-l,4- dihydroquinoline-3-carboxylate (D)

Sodium hydride (60% in mineral oil, 82 mg, 2.1 mmol) is added portionwise to a solution of C (760 mg, 1.95 mmol) in dimethylformamide (15 mL) at room temperature. The reaction mixture is heated at 80 0C for 3 d (until TLC indicates the complete consumption of B), cooled to room temperature, and quenched by addition of a saturated aqueous solution of ammonium chloride (10 mL). The mixture is extracted with ethyl acetate (3 x 50 mL). The combined organic extracts are washed with brine (4 x 30 mL), dried over sodium sulfate, and evaporated under reduced pressure to give crude D. This material is purified by flash column chromatography (eluting with 30% v/v ethyl acetate in hexanes) to D as a pale yellow oil.1H NMR (300 MHz, CDCl3): £0.73 (m, 2H, cyclopropyl CH2), 1.19 (m, 2H, cyclopropyl CH2), 1.38 (t, JHH = 7.0 Hz, 3H, CO2CH2CH3), 2.66 (s, 3Η, SCH3), 3.74 (m, IH, cyclopropyl CH), 4.08 (d, JHF = 2.5 Hz 3H, OCH3), 4.40 (q, JH_H = 7.0 Hz, 2H, CO2CH2CH3), 7.76 (dd, JH_F = 10.5 Hz, 8.5 Hz IH, aromatic). 19F(1H) NMR (282 MHz, CDCl3): £-146.8 (d, JF_F = 21.0 Hz, IF), – 137.7 (d, JFF = 21.0 Hz, IF). LCMS mlz calcd for C17H17F2NO4S 369 ([M+]); found 370 ([M + H]+).

Step 5. Synthesis of ethyl l-cyclopropyl-6,7-difluoro-8-methoxy-2-(methylsulfinyl)-4-oxo-l,4- dihydroquinoline-3-carboxylate (E)

m-Chloroperoxybenzoic acid (<77%, 34 mg, 0.15 mmol) is added in one portion to a solution of D (50 mg, 0.14 mmol) in methylene chloride (3 mL) at room temperature. The reaction mixture is stirred for 1 h, diluted with ethyl acetate (20 mL), and washed with a 5% aqueous solution of sodium bicarbonate (2 x 10 mL). The organic layer is dried over sodium sulfate and evaporated under reduced pressure to give the crude product. This material is purified by preparative thin-layer chromatography (eluting with 10% v/v hexanes in ethyl acetate) to give pure E as a white solid. 1H NMR (300 MHz, CDCl3): £0.62 (m, IH, cyclopropyl CH2), 1.00 (m, IH, cyclopropyl CH2), 1.13 (m, IH, cyclopropyl CH2), 1.29 (m, IH, cyclopropyl CH2), 1.36 (t, JH_H = 7.5 Hz, 3H, CO2CH2CH3), 3.22 (s, 3Η, S(O)CH3), 3.85 (m, IH, cyclopropyl CH), 4.09 (d, JH-F = 2.5 Hz, 3H, OCH3), 4.37 (q, JHH = 7.5 Hz, 2H, CO2CH2CH3), 7.75 (dd, JHF = 10.0, 8.0 Hz, IH, aromatic). 19F(1H) NMR (282 MHz, CDCl3): £-145.2 (d, JF_F = 21.0 Hz, IF), -136.2 (d, JF_F = 21.0 Hz, IF). LCMS mlz calcd for C17H17F2NO5S 385 ([M+]); found 386 ([M + H]+).

Step 6. Synthesis of ethyl l-cyclopropyl-βJ-difluoro-l-mercaptoS-methoxy-^oxo-lA- dihydroquinoline-3-carboxylate (F).

Anhydrous sodium hydrogen sulfide (Alfa Aesar, 20 mg, 0.36 mmol) is added in one portion to a solution of DMF (6 mL) containing E (93 mg, 0.24 mmol) at room temperature. The resulting solution is heated at 40 0C for 2-3 h (until TLC indicated complete consumption of E) and allowed to cool to room temperature. The reaction mixture is quenched by addition of a 5% aqueous solution of hydrochloric acid (20 mL) and extracted with ethyl acetate (2 x 25 mL). The combined organic extracts are washed with brine (4 x 25 mL), dried over sodium sulfate, and evaporated to dryness under reduced pressure to give crude F in quantitative yield. This material is used directly in the next synthetic step to prevent its oxidative degradation. LCMS mlz calcd for C16H15F2NO4S 355 ([M+]); found 356 ([M + H]+) Step 7. Synthesis of9-cyclopropyl-6,7-difluoro-8-methoxyisothiazolo[5,4-b]quinoline- 3,4(2H,9H)-dione (3).

A solution of sodium bicarbonate (820 mg, 9.8 mmol) in water (14 mL) is added to a solution of F (348 mg, 0.98 mmol) in tetrahydrofuran (10 mL) at room temperature. Hydroxylamine-O-sulfonic acid (465 mg, 4.1 mmol) is added in one portion to this mixture. The reaction mixture is stirred at room temperature for ~3 h and quenched by addition of an aqueous solution of 5% hydrochloric acid (100 mL). The precipitate that formed is collected by filtration, washed with water (3 x 5 mL), and dried in vacuo to give 3 as a white solid. This product is of sufficient purity (>95% by 1H NMR spectroscopy) to use directly in the final amine-coupling step. 1HNMR (300 MHz, DMSO-J6): Jl.12 (m, 4H, cyclopropyl CH2), 3.85 (m, IH, cyclopropyl CH), 4.01 (d, JHF= 1.5 Hz, 3H, OCH3), 7.85 (dd, JH_F = 11.0 Hz, 9.0 Hz, IH, aromatic). 19F(1H) NMR (282 MHz, DMSO-J6): £-146.4 (d, JF_F = 23.0 Hz, IF), -140.2 (d, JFF = 23.0 Hz, IF). LCMS mlz calcd for C14H10F2N2O3S 324 ([M*]); found 325 ([M + H]+).

 

REFERENCES

  1. Achillion Pharmaceuticals. About ACH-702. Available online: http://www.achillion.com/PL/pdf/04_ach_702_bg.pdf (accessed on 2 May 2013).
  2. Pucci, M.J.; Podos, S.D.; Thanassi, J.A.; Leggio, M.J.; Bradbury, B.J.; Deshpande, M. In vitro and in vivoprofiles of ACH-702, an isothiazoloquinolone, against bacterial pathogens. Antimicrob. Agents Chemother. 201155, 2860–2871, doi:10.1128/AAC.01666-10.
  3. Achillion Pharmaceuticals, Inc. SEC filling form 10-Q quarterly report filed August 7, 2013. Available online: http://ir.achillion.com/secfiling.cfm?filingID=1193125–13–324297 (accessed on 28 September 2013).
  4. An efficient method for the synthesis of (R)-3-(1-amino-1-methylethyl)pyrrolidines for the antiinfective agent, PD 138312
    Tetrahedron Asymmetry 1994, 5(7): 1131
  5. WO 2007014308
  6. WO 2008021491
  7. WO2011031745A1 Sep 8, 2010 Mar 17, 2011 Achaogen, Inc. Antibacterial fluoroquinolone analogs
  8. HASHIMOTO, A. ET AL.: “Practical synthesis and molecular structure of a potent broad-spectrum antibacterial isothiazoloquinolone” ORG. PROCESS RESEARCH & DEVELOPMENT, vol. 11, 16 March 2007 (2007-03-16), pages 389-398, XP002465315
    2 * WANG, Q. ET AL.: “Isothiazoloquinolones with Enhanced Antistaphylococcal Activities against Multidrug-Resistant Strains: Effects of Structural Modifications at the 6-, 7-, and 8-Positions” J. MED. CHEM., vol. 50, 2007, pages 199-210, XP002465316
  9. WO2005019228A1 * Aug 4, 2004 Mar 3, 2005 Achillion Pharmaceuticals Inc Isothiazoloquinolones and related compounds as anti-infective agents
    WO2006118605A2 * Nov 10, 2005 Nov 9, 2006 Achillion Pharmaceuticals Inc 8a, 9-dihydro-4a-h-isothiazolo[5,4-b] quinoline-3, 4-diones and related compounds as anti-infective agents
    WO2007014308A1 * Jul 27, 2006 Feb 1, 2007 Achillion Pharmaceuticals Inc 8-methoxy-9h-isothiazolo[5,4-b]quinoline-3,4-diones and related compounds as anti-infective agents
  10. Citing Patent Filing date Publication date Applicant Title
    WO2008021491A2 * Aug 16, 2007 Feb 21, 2008 Achillion Pharmaceuticals Inc Method for synthesis of 8-alkoxy-9h-isothiazolo[5,4-b]quinoline-3,4-diones
    WO2011031745A1 Sep 8, 2010 Mar 17, 2011 Achaogen, Inc. Antibacterial fluoroquinolone analogs
    EP2488532A2 * Oct 15, 2010 Aug 22, 2012 Rib-X Pharmaceuticals, Inc. Antimicrobial compounds and methods of making and using the same
    US7902365 Aug 16, 2007 Mar 8, 2011 Achillion Pharmaceuticals, Inc. Method for synthesis of 8-alkoxy-9H-isothiazolo[5,4-B]quinoline-3,4-diones
    US8138346 Mar 4, 2011 Mar 20, 2012 Achillion Pharmaceuticals, Inc. Method for synthesis of 8-alkoxy-9H-isothiazolo[5,4-B]quinoline-3,4-diones

MG 96077 in Pre-Clinical for Gram-negative bacteria


Antibiotics 02 00500 i036

MG 96077

poster

MG96077 – MethylGene

………..http://methylgene.solocom.biz/files/2011/10/poster102.pdf     ……………..lot of data presented

Mirati Therapeutics (USA)

Pre-Clinical for Gram-negative bacteria

Beta-Lactamase Inhibitors—Non-beta-Lactam Phosphonate-Based

Mirati Therapeutics is seeking partners to continue the development of the compound MG96077, a non-beta-lactam phosphonate-based beta-lactamase inhibitor that has shown an inhibitory profile for both class A and class C beta-lactamase enzymes [1,2].

Potent, irreversible inhibitor of serine β-lactamases that efficiently protects βlactams from hydrolysis in a variety of class
A- and class C-producing organisms-

 

MethylGene Inc.

September 14, 2009 13:23 ET

MethylGene Presents Preclinical Data for Its Beta-Lactamase Inhibitor, MG96077, at the 49th Annual ICAAC Meeting

 

MONTREAL, QUEBEC–(Marketwire – Sept. 14, 2009) – MethylGene Inc. (TSX:MYG) today disclosed preclinical data for MG96077, a novel, broad spectrum, non-beta-lactam beta-lactamase inhibitor (BLI). MG96077 possesses a broad-spectrum inhibitory profile for both class A and class C beta-lactamase enzymes, including extended spectrum beta-lactamases (ESBLs). In addition, the compound overcomes resistance in beta-lactam-resistant organisms such as Pseudomonas aeruginosa. The data were presented in a poster session at the 49th Annual Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) Annual Meeting in San Francisco, California.

Poster C1-1373: Novel Beta-Lactamase Inhibitor Potentiates and Extends the Antibacterial Activity of Imipenem against Beta-Lactam-Resistant P. aeruginosa and K. pneumoniae

MG96077 was tested in combination with imipenem, a commonly-used antibiotic agent for a variety of serious infections.

A series of in vitro and in vivo preclinical studies focused on comparing the combination of MG96077 and imipenem to imipenem alone, or imipenem plus currently approved BLIs, were performed. Greater than 90 percent of imipenem-resistant clinical isolates of Pseudomonas aeruginosa and Klebsiella pneumoniae were rendered susceptible with the addition of MG96077 to imipenem. The combination of imipenem and any of the three currently approved BLIs did not achieve greater than 61 percent coverage.

Furthermore, the combination of imipenem and MG96077 in vivo demonstrated 3-6 log reduction in colony forming units (CFU) and a 100 percent survival rate in combating imipenem-resistant P. aeruginosa infections of mouse spleen and lung. The pharmacokinetic properties of MG96077 were similar to imipenem in preclinical studies with no observable drug-drug interactions.

Thus, MG96077 is a novel beta-lactamase inhibitor that restores efficacy to imipenem against a high percentage of imipenem-resistant Pseudomonas and Klebsiella strains and, therefore, may address the clinical need for antibacterial therapies with more potent coverage of resistant gram-negative organisms.

MethylGene retains exclusive rights to MG96077 and a series of related molecules. Additional data has been developed regarding MG96077 compared to other beta-lactam antibiotics, as well as other compounds in the series paired with various beta-lactam antibiotics.

“Antibiotic resistance rates are increasing among several problematic gram-negative pathogens, including P. aeruginosa, K. pneumoniae, Acinetobacter spp. and Enterobacteriaceae that are often responsible for serious hospital-acquired infections. In these studies, MG96077 appears to demonstrate activity in a variety of organisms and we look forward to further evaluation of this compound in what is a growing antibiotic market in need of novel treatments,” said Donald F. Corcoran, President and Chief Executive Officer of MethylGene.

About MethylGene

MethylGene Inc. (TSX:MYG) is a publicly-traded, clinical stage, biopharmaceutical company focused on the discovery, development and commercialization of novel therapeutics with a focus on cancer. The Company’s product candidates include: MGCD265, an oral, multi-targeted kinase inhibitor targeting the c-Met, VEGF, Ron and Tie-2 receptor tyrosine kinases that is in Phase I and Phase II clinical trials for cancers; MGCD290, a fungal Hos2 inhibitor being developed for use in combination with fluconazole for serious fungal infections that is in Phase I clinical studies; and MGCD0103, an oral, isoform-selective HDAC inhibitor which has been in multiple clinical trials for solid tumors and hematological malignancies and is licensed to Taiho Pharmaceutical Co. Ltd. A fourth compound discovered using MethylGene’s HDAC platform, EVP-0334 – a potential cognition enhancing agent, is in a Phase I study sponsored by EnVivo Pharmaceuticals Inc. MethylGene also has a funded collaboration with Otsuka Pharmaceutical Co. Ltd. for applications in ocular diseases using the Company’s proprietary kinase inhibitor chemistry. Please visit our website at www.methylgene.com.

 

  1. Martell, L.A.; Rahil, G.; Vaisburg, A.; Young, K.; Hickey, E.; Hermes, J.; Dininno, F.; Besterman, J.M. A Novel Beta-Lactamase Inhibitor Potentiates and Extends the Antibacterial Activity of Imipenem against β-Lactam-Resistant P. aeruginosa and K. pneumoniae. In Proceedings of 49th ICAAC Annual Meeting, San Francisco, CA, USA, 14 September 2009.
  2. Mirati Therapeutics. MG96077. Available online: http://mirati.com/other-pipeline-assets/mg96077(accessed on 9 July 2013).
  3. 49th Annual Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) Annual Meeting in San Francisco, California.
    Poster C1-1373: Novel Beta-Lactamase Inhibitor Potentiates and Extends the Antibacterial Activity of Imipenem against Beta-Lactam-Resistant P. aeruginosa and K. pneumoniae

ATL1102 for MS – Toxicology Study Main Findings


Sequence TypeDNA fragment
CTGAGTCTGTTTTCCATTCT

ATL 1102

The antisense oligonucleotide is complementary to a region in the 3’UTR of human ITGA4 (integrin alpha 4) cDNA whose sequence is 5′-CTGAGTCTGTTTTCCATTCT-3′
Phosphorothioate antisense oligonucleotide consisting of a 9-nucleotide central region of deoxynucleotides flanked by 3 2′-O-methoxyethyl (2′-MOE) nucleotides on the 5′ end and 8 2′-MOE nucleotides on the 3′ end.

TOORAK, Australia, April 1, 2014 /PRNewswire/ — Antisense Therapeutics Limited (“ANP” or the “Company”) is pleased to advise that results from a chronic toxicity study in monkeys indicate that ATL1102, an antisense oligonucleotide currently under development for the treatment of multiple sclerosis (MS), was well-tolerated when given subcutaneously for a 6-month dosing period at the 2 dose levels tested (1.5 and 3mg/kg/dose). The Company believes that the preclinical and clinical experience to date with ATL1102 should allow dosing in future trials at or above the 1.5 mg/kg/dose level.

read at

http://www.sys-con.com/node/3037721

 

ATL-1102
ISIS-107248
TV-1102

ITGA4 Expression Inhibitors

Signal Transduction Modulators

PHASE 2

Antisense Therapeutics
Isis Pharmaceuticals

Antisense Therapeutics Limited (ASX: ANP) is an Australian publicly listed biopharmaceutical drug discovery and development company. Its mission is to create, develop and commercialise second generation antisense pharmaceuticals for large unmet markets. ANP has 4 products in its development pipeline that it has in-licensed from Isis Pharmaceuticals Inc., world leaders in antisense drug development and commercialisation – ATL1102 (injection) which has successfully completed a Phase II efficacy and safety trial, significantly reducing the number of brain lesions in patients with multiple sclerosis, ATL1103 a second-generation antisense drug designed to block GHr production and thereby lower blood IGF-I levels and is in clinical development as a potential treatment for growth and other GH-IGF-I disorders, ATL1102 (inhaled) which is at the pre-clinical research stage as a potential treatment for asthma and ATL1101 a second-generation antisense drug at the pre-clinical stage being investigated as a potential treatment for cancer.

ATL1102 is a second generation antisense inhibitor of CD49d, a subunit of VLA-4 (Very Late Antigen-4). In inflammation, white blood cells (leukocytes) move out of the bloodstream into the inflamed tissue, for example, the Central Nervous System (CNS) in MS, and the lung airways in asthma. The inhibition of VLA-4 may prevent white blood cells from entering sites of inflammation, thereby slowing progression of the disease. VLA-4 is a clinically validated target in the treatment of MS. Antisense inhibition of VLA-4 has demonstrated positive effects in a number of animal models of inflammatory disease including MS with the MS animal data having been published in a peer reviewed scientific journal. ATL1102 was previously shown by Antisense Therapeutics to be highly effective in reducing MS lesions in a Phase IIa clinical trial in MS patients.

ATL-1102 is an antisense oligonucleotide in phase II clinical trials at Isis Pharmaceuticals and Antisense Therapeutics for the treatment of relapsing-remitting multiple sclerosis (MS) in a subcutaneous injection formulation. Phase I clinical trials in a subcutaneous injections for stem cell mobilization and preclinical studies of an inhalation formulation of the drug candidate for the treatment of asthma are also being conducted at Antisense Therapeutics.

ATL-1102 is complementary to nt 4288-4207 (3’UTR) of human integrin alpha 4 (ITGA4) cDNA, and thus inhibits ITGA4 expression, blocking the synthesis of CD49d, a subunit of very late antigen-4 (VLA-4). VLA-4 is known to play a part in both the onset and progression of MS, and its inhibition may prevent white blood cells from entering the central nervous system.

ATL-1102 was originally developed at Isis Pharmaceuticals. In December 2001, Isis and Circadian Technologies formed Antisense Therapeutics, established to focus on the discovery and development of antisense therapeutics. As part of the company’s formation, Antisense Therapeutics received a license to ATL-1102 and entered into a five-year antisense drug discovery and development program with Isis. In 2008, Antisense licensed ATL-1102 to Teva. In 2010, Teva terminated its licensee agreement with Antisense for the development of ATL-1102 for the treatment of relapsing-remitting multiple sclerosis. The company stated that the compound was not on line with its preferred product pipeline. In 2001, ATL-1102 was licensed to Antisense Therapeutics by Isis Pharmaceuticals. In 2012, development and commercialization rights to the product were licensed to Tianjin International Joint Academy of Biotechnology and

Contact Information:
Website: www.antisense.com.au
Managing Director: Mark Diamond +61 (3) 9827 8999
USA Investor/Media: Joshua Drumm +(1) 212 375 2664;jdrumm@tiberend.com
Australia Investor/Media: Simon Watkin +61 (0)413 153 272;simon@marketconnect.com.au

SOURCE Antisense Therapeutics Limited