New Drug Approvals

Home » Articles posted by DR ANTHONY MELVIN CRASTO Ph.D (Page 303)

Author Archives: DR ANTHONY MELVIN CRASTO Ph.D

DRUG APPROVALS BY DR ANTHONY MELVIN CRASTO .....FOR BLOG HOME CLICK HERE

Blog Stats

  • 4,930,569 hits

Flag and hits

Flag Counter

Enter your email address to follow this blog and receive notifications of new posts by email.

Join 37.8K other subscribers
Follow New Drug Approvals on WordPress.com

Archives

Categories

Recent Posts

Flag Counter

ORGANIC SPECTROSCOPY

Read all about Organic Spectroscopy on ORGANIC SPECTROSCOPY INTERNATIONAL 

Enter your email address to follow this blog and receive notifications of new posts by email.

Join 37.8K other subscribers
DR ANTHONY MELVIN CRASTO Ph.D

DR ANTHONY MELVIN CRASTO Ph.D

DR ANTHONY MELVIN CRASTO, Born in Mumbai in 1964 and graduated from Mumbai University, Completed his Ph.D from ICT, 1991,Matunga, Mumbai, India, in Organic Chemistry, The thesis topic was Synthesis of Novel Pyrethroid Analogues, Currently he is working with AFRICURE PHARMA, ROW2TECH, NIPER-G, Department of Pharmaceuticals, Ministry of Chemicals and Fertilizers, Govt. of India as ADVISOR, earlier assignment was with GLENMARK LIFE SCIENCES LTD, as CONSUlTANT, Retired from GLENMARK in Jan2022 Research Centre as Principal Scientist, Process Research (bulk actives) at Mahape, Navi Mumbai, India. Total Industry exp 32 plus yrs, Prior to joining Glenmark, he has worked with major multinationals like Hoechst Marion Roussel, now Sanofi, Searle India Ltd, now RPG lifesciences, etc. He has worked with notable scientists like Dr K Nagarajan, Dr Ralph Stapel, Prof S Seshadri, etc, He did custom synthesis for major multinationals in his career like BASF, Novartis, Sanofi, etc., He has worked in Discovery, Natural products, Bulk drugs, Generics, Intermediates, Fine chemicals, Neutraceuticals, GMP, Scaleups, etc, he is now helping millions, has 9 million plus hits on Google on all Organic chemistry websites. His friends call him Open superstar worlddrugtracker. His New Drug Approvals, Green Chemistry International, All about drugs, Eurekamoments, Organic spectroscopy international, etc in organic chemistry are some most read blogs He has hands on experience in initiation and developing novel routes for drug molecules and implementation them on commercial scale over a 32 PLUS year tenure till date Feb 2023, Around 35 plus products in his career. He has good knowledge of IPM, GMP, Regulatory aspects, he has several International patents published worldwide . He has good proficiency in Technology transfer, Spectroscopy, Stereochemistry, Synthesis, Polymorphism etc., He suffered a paralytic stroke/ Acute Transverse mylitis in Dec 2007 and is 90 %Paralysed, He is bound to a wheelchair, this seems to have injected feul in him to help chemists all around the world, he is more active than before and is pushing boundaries, He has 100 million plus hits on Google, 2.5 lakh plus connections on all networking sites, 100 Lakh plus views on dozen plus blogs, 227 countries, 7 continents, He makes himself available to all, contact him on +91 9323115463, email amcrasto@gmail.com, Twitter, @amcrasto , He lives and will die for his family, 90% paralysis cannot kill his soul., Notably he has 38 lakh plus views on New Drug Approvals Blog in 227 countries......https://newdrugapprovals.wordpress.com/ , He appreciates the help he gets from one and all, Friends, Family, Glenmark, Readers, Wellwishers, Doctors, Drug authorities, His Contacts, Physiotherapist, etc He has total of 32 International and Indian awards

Verified Services

View Full Profile →

Archives

Categories

Flag Counter

MG 96077 in Pre-Clinical for Gram-negative bacteria


Antibiotics 02 00500 i036

MG 96077

poster

MG96077 – MethylGene

………..http://methylgene.solocom.biz/files/2011/10/poster102.pdf     ……………..lot of data presented

Mirati Therapeutics (USA)

Pre-Clinical for Gram-negative bacteria

Beta-Lactamase Inhibitors—Non-beta-Lactam Phosphonate-Based

Mirati Therapeutics is seeking partners to continue the development of the compound MG96077, a non-beta-lactam phosphonate-based beta-lactamase inhibitor that has shown an inhibitory profile for both class A and class C beta-lactamase enzymes [1,2].

Potent, irreversible inhibitor of serine β-lactamases that efficiently protects βlactams from hydrolysis in a variety of class
A- and class C-producing organisms-

 

MethylGene Inc.

September 14, 2009 13:23 ET

MethylGene Presents Preclinical Data for Its Beta-Lactamase Inhibitor, MG96077, at the 49th Annual ICAAC Meeting

 

MONTREAL, QUEBEC–(Marketwire – Sept. 14, 2009) – MethylGene Inc. (TSX:MYG) today disclosed preclinical data for MG96077, a novel, broad spectrum, non-beta-lactam beta-lactamase inhibitor (BLI). MG96077 possesses a broad-spectrum inhibitory profile for both class A and class C beta-lactamase enzymes, including extended spectrum beta-lactamases (ESBLs). In addition, the compound overcomes resistance in beta-lactam-resistant organisms such as Pseudomonas aeruginosa. The data were presented in a poster session at the 49th Annual Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) Annual Meeting in San Francisco, California.

Poster C1-1373: Novel Beta-Lactamase Inhibitor Potentiates and Extends the Antibacterial Activity of Imipenem against Beta-Lactam-Resistant P. aeruginosa and K. pneumoniae

MG96077 was tested in combination with imipenem, a commonly-used antibiotic agent for a variety of serious infections.

A series of in vitro and in vivo preclinical studies focused on comparing the combination of MG96077 and imipenem to imipenem alone, or imipenem plus currently approved BLIs, were performed. Greater than 90 percent of imipenem-resistant clinical isolates of Pseudomonas aeruginosa and Klebsiella pneumoniae were rendered susceptible with the addition of MG96077 to imipenem. The combination of imipenem and any of the three currently approved BLIs did not achieve greater than 61 percent coverage.

Furthermore, the combination of imipenem and MG96077 in vivo demonstrated 3-6 log reduction in colony forming units (CFU) and a 100 percent survival rate in combating imipenem-resistant P. aeruginosa infections of mouse spleen and lung. The pharmacokinetic properties of MG96077 were similar to imipenem in preclinical studies with no observable drug-drug interactions.

Thus, MG96077 is a novel beta-lactamase inhibitor that restores efficacy to imipenem against a high percentage of imipenem-resistant Pseudomonas and Klebsiella strains and, therefore, may address the clinical need for antibacterial therapies with more potent coverage of resistant gram-negative organisms.

MethylGene retains exclusive rights to MG96077 and a series of related molecules. Additional data has been developed regarding MG96077 compared to other beta-lactam antibiotics, as well as other compounds in the series paired with various beta-lactam antibiotics.

“Antibiotic resistance rates are increasing among several problematic gram-negative pathogens, including P. aeruginosa, K. pneumoniae, Acinetobacter spp. and Enterobacteriaceae that are often responsible for serious hospital-acquired infections. In these studies, MG96077 appears to demonstrate activity in a variety of organisms and we look forward to further evaluation of this compound in what is a growing antibiotic market in need of novel treatments,” said Donald F. Corcoran, President and Chief Executive Officer of MethylGene.

About MethylGene

MethylGene Inc. (TSX:MYG) is a publicly-traded, clinical stage, biopharmaceutical company focused on the discovery, development and commercialization of novel therapeutics with a focus on cancer. The Company’s product candidates include: MGCD265, an oral, multi-targeted kinase inhibitor targeting the c-Met, VEGF, Ron and Tie-2 receptor tyrosine kinases that is in Phase I and Phase II clinical trials for cancers; MGCD290, a fungal Hos2 inhibitor being developed for use in combination with fluconazole for serious fungal infections that is in Phase I clinical studies; and MGCD0103, an oral, isoform-selective HDAC inhibitor which has been in multiple clinical trials for solid tumors and hematological malignancies and is licensed to Taiho Pharmaceutical Co. Ltd. A fourth compound discovered using MethylGene’s HDAC platform, EVP-0334 – a potential cognition enhancing agent, is in a Phase I study sponsored by EnVivo Pharmaceuticals Inc. MethylGene also has a funded collaboration with Otsuka Pharmaceutical Co. Ltd. for applications in ocular diseases using the Company’s proprietary kinase inhibitor chemistry. Please visit our website at www.methylgene.com.

 

  1. Martell, L.A.; Rahil, G.; Vaisburg, A.; Young, K.; Hickey, E.; Hermes, J.; Dininno, F.; Besterman, J.M. A Novel Beta-Lactamase Inhibitor Potentiates and Extends the Antibacterial Activity of Imipenem against β-Lactam-Resistant P. aeruginosa and K. pneumoniae. In Proceedings of 49th ICAAC Annual Meeting, San Francisco, CA, USA, 14 September 2009.
  2. Mirati Therapeutics. MG96077. Available online: http://mirati.com/other-pipeline-assets/mg96077(accessed on 9 July 2013).
  3. 49th Annual Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) Annual Meeting in San Francisco, California.
    Poster C1-1373: Novel Beta-Lactamase Inhibitor Potentiates and Extends the Antibacterial Activity of Imipenem against Beta-Lactam-Resistant P. aeruginosa and K. pneumoniae

ATL1102 for MS – Toxicology Study Main Findings


Sequence TypeDNA fragment
CTGAGTCTGTTTTCCATTCT

ATL 1102

The antisense oligonucleotide is complementary to a region in the 3’UTR of human ITGA4 (integrin alpha 4) cDNA whose sequence is 5′-CTGAGTCTGTTTTCCATTCT-3′
Phosphorothioate antisense oligonucleotide consisting of a 9-nucleotide central region of deoxynucleotides flanked by 3 2′-O-methoxyethyl (2′-MOE) nucleotides on the 5′ end and 8 2′-MOE nucleotides on the 3′ end.

TOORAK, Australia, April 1, 2014 /PRNewswire/ — Antisense Therapeutics Limited (“ANP” or the “Company”) is pleased to advise that results from a chronic toxicity study in monkeys indicate that ATL1102, an antisense oligonucleotide currently under development for the treatment of multiple sclerosis (MS), was well-tolerated when given subcutaneously for a 6-month dosing period at the 2 dose levels tested (1.5 and 3mg/kg/dose). The Company believes that the preclinical and clinical experience to date with ATL1102 should allow dosing in future trials at or above the 1.5 mg/kg/dose level.

read at

http://www.sys-con.com/node/3037721

 

ATL-1102
ISIS-107248
TV-1102

ITGA4 Expression Inhibitors

Signal Transduction Modulators

PHASE 2

Antisense Therapeutics
Isis Pharmaceuticals

Antisense Therapeutics Limited (ASX: ANP) is an Australian publicly listed biopharmaceutical drug discovery and development company. Its mission is to create, develop and commercialise second generation antisense pharmaceuticals for large unmet markets. ANP has 4 products in its development pipeline that it has in-licensed from Isis Pharmaceuticals Inc., world leaders in antisense drug development and commercialisation – ATL1102 (injection) which has successfully completed a Phase II efficacy and safety trial, significantly reducing the number of brain lesions in patients with multiple sclerosis, ATL1103 a second-generation antisense drug designed to block GHr production and thereby lower blood IGF-I levels and is in clinical development as a potential treatment for growth and other GH-IGF-I disorders, ATL1102 (inhaled) which is at the pre-clinical research stage as a potential treatment for asthma and ATL1101 a second-generation antisense drug at the pre-clinical stage being investigated as a potential treatment for cancer.

ATL1102 is a second generation antisense inhibitor of CD49d, a subunit of VLA-4 (Very Late Antigen-4). In inflammation, white blood cells (leukocytes) move out of the bloodstream into the inflamed tissue, for example, the Central Nervous System (CNS) in MS, and the lung airways in asthma. The inhibition of VLA-4 may prevent white blood cells from entering sites of inflammation, thereby slowing progression of the disease. VLA-4 is a clinically validated target in the treatment of MS. Antisense inhibition of VLA-4 has demonstrated positive effects in a number of animal models of inflammatory disease including MS with the MS animal data having been published in a peer reviewed scientific journal. ATL1102 was previously shown by Antisense Therapeutics to be highly effective in reducing MS lesions in a Phase IIa clinical trial in MS patients.

ATL-1102 is an antisense oligonucleotide in phase II clinical trials at Isis Pharmaceuticals and Antisense Therapeutics for the treatment of relapsing-remitting multiple sclerosis (MS) in a subcutaneous injection formulation. Phase I clinical trials in a subcutaneous injections for stem cell mobilization and preclinical studies of an inhalation formulation of the drug candidate for the treatment of asthma are also being conducted at Antisense Therapeutics.

ATL-1102 is complementary to nt 4288-4207 (3’UTR) of human integrin alpha 4 (ITGA4) cDNA, and thus inhibits ITGA4 expression, blocking the synthesis of CD49d, a subunit of very late antigen-4 (VLA-4). VLA-4 is known to play a part in both the onset and progression of MS, and its inhibition may prevent white blood cells from entering the central nervous system.

ATL-1102 was originally developed at Isis Pharmaceuticals. In December 2001, Isis and Circadian Technologies formed Antisense Therapeutics, established to focus on the discovery and development of antisense therapeutics. As part of the company’s formation, Antisense Therapeutics received a license to ATL-1102 and entered into a five-year antisense drug discovery and development program with Isis. In 2008, Antisense licensed ATL-1102 to Teva. In 2010, Teva terminated its licensee agreement with Antisense for the development of ATL-1102 for the treatment of relapsing-remitting multiple sclerosis. The company stated that the compound was not on line with its preferred product pipeline. In 2001, ATL-1102 was licensed to Antisense Therapeutics by Isis Pharmaceuticals. In 2012, development and commercialization rights to the product were licensed to Tianjin International Joint Academy of Biotechnology and

Contact Information:
Website: www.antisense.com.au
Managing Director: Mark Diamond +61 (3) 9827 8999
USA Investor/Media: Joshua Drumm +(1) 212 375 2664;jdrumm@tiberend.com
Australia Investor/Media: Simon Watkin +61 (0)413 153 272;simon@marketconnect.com.au

SOURCE Antisense Therapeutics Limited

 

MK 2048 an HIV integrase inhibitor from Merck


File:MK-2048.svg

MK 2048

Molecular Formula: C21H21ClFN5O4   Molecular Weight: 461.873943

869901-69-9, 3oyl, 3oyn

Merck & Co., Inc.

 

 

(6S)-2-(3-chloro-4-fluorobenzyl)-8-ethyl-10-hydroxy-N,6-dimethyl-1,9-dioxo-1,2,6,7,8,9-hexahydropyrazino‌[1′,2′:1,5]‌pyrrolo‌[2,3-d]‌pyridazine-4-carboxamide

6(S)-2-(3-Chloro-4-fluorobenzyl)-8-ethyl-10-hydroxy-N,6-dimethyl-l,9-dioxo-l,2,6,7,8,9- hexahydropyrazino[r,2′:l,5]pyrrolo[2,3-d]pyridazine-4-carboxamide

 

5-27-2009
Hiv Integrase Inhibitors

 

MK-2048 is a second generation integrase inhibitor, intended to be used against HIV infection. It is superior to the first available integrase inhibitor,raltegravir, in that it inhibits the HIV enzyme integrase 4 times longer. It is being investigated for use as part of pre-exposure prophylaxis (PrEP). [1]

It is being developed by Merck & Co.[2]

MK-2048 is a second generation integrase inhibitor for HIV-1 integrase. MK-2048 inhibits subtype B and subtype C integrase activities. MK-2048 inhibits R263K mutants slightly more effectively than G118R mutants.

MK-2048 inhibits S217H intasome and, by contrast, MK2048 remains fully active against the N224H intasome. MK2048 displays substantially lower dissociation rates compared with raltegravir, another integrase inhibitor.

MK-2048 is active against viruses resistant to RAL and EVG. MK-2048 exposure leads to the selection of G118R as a possible novel resistance mutation after 19 weeks. MK-2048, with continued pressure, subsequently leads to an additional substitution, at position E138K, after 29 weeks, within the IN gene.

Although the G118R mutation alone confers only slight resistance to MK-2048 but not to RAL or EVG, its presence arouses a dramatic reduction in viral replication capacity compared to wild-type NL4-3. E138K both partially restores viral replication capacity and also contributes to increased levels of resistance against MK-2048.

Structure of MK-2048 with important pharmacophore highlighted

 

…………………..

Synthesis

WO2005110415A1

http://www.google.as/patents/WO2005110415A1?cl=en

EXAMPLE 62 6(S)-2-(3-Chloro-4-fluorobenzyl)-8-ethyl-10-hydroxy-N,6-dimethyl-l,9-dioxo-l,2,6,7,8,9- hexahydropyrazino[r,2′:l,5]pyrrolo[2,3-d]pyridazine-4-carboxamide

 

Figure imgf000048_0002

Step 1: te rt-Butyl[( 1 S)-2-(ethylamino)- 1 -methylethyl] carbamate To a cold (0 °C) solution of N-(tø/ -butoxycarbonyl)-L-alanine N’-methoxy-N’- methylamide (15.6 g, 67.2 mmol) in anhydrous THF (150 mL) and diethyl ether (400 mL), solid lithium aluminum hydride (5.1 g, 134.3 mmol) was added portionwise over a period of 30 minutes. The mixture was stirred at room temperature for 3 hours and cooled back to 0 °C. The reaction was treated carefully with an aqueous solution of potassium hydrogen sulfate (250 mL, 1M). The resultant mixture was diluted with diethyl ether.

The organic extract was washed successively with dilute hydrochloric acid, and brine, dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum to provide the corresponding aldehyde as colorless solid. Without further purification, a cold (0 °C), stirred solution of the intermediate aldehyde (10.7 g, 61.8 mmol) and ethylamine hydrogen chloride (10.1 g, 123.5 mmol) in methanol (72 mL) was treated with sodium triacetoxyborohydride (17.2 g, 80.9 mmol) in one portion. The mixture was allowed to warm up to room temperature.

After stirring at room temperature overnight, the solution was concentrated under vacuum. The residue was partitioned between diethyl ether and cold aqueous sodium hydroxide (1.5 M). The ethereal extract was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum to provide the titled compound. lH NMR (400 MHz, CDCI3) δ 4.68 (br s, IH), 3.75 (br t, IH), 2.62 (m, 5 H), 1.13 (d, J = 6.7 Hz, 3H),

1.09 (t, J = 7.0 Hz, 3H). ES MS M+l = 203

Step 2: ført-Butyl { ( 1 S)-2-[(bromoacetyl)ethylamino] – 1 -methylethyl } carbamate To a cold (0 °C) stirred solution of ?ert-butyl[(lS)-2-(ethylamino)-l- methylethyl]carbamate (11.0 g, 54.6 mmol) in a mixture of ethyl acetate (107 mL) and saturated aqueous sodium bicarbonate (65 mL), bromoacetyl bromide (12.1 g, 60.0 mmol) was added portionwise under an atmosphere of nitrogen. The mixture was allowed to warm up to room temperature over a period of 3.5 hours. The organic phase was separated, washed successively with saturated aqueous sodium bicarbonate, and brine. The organic extract was dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum. The residue was concentrated as a solution in toluene under vacuum to afford the title compound. ES MS M+l = 323, 325.

Step 3: fe7 -Butyl (2S)-4-ethyl-2-methyl-5-oxopiperazine-l-carboxylate To a stirred slurry of sodium hydride (1.7 g, 69.8 mmol) in anhydrous THF (800 mL), a solution of tert-butyl{(lS)-2-[(bromoacetyl)ethylamino]-l-methylethyl}carbamate (17.4 g, 53.7 mmol) in anhydrous THF (100 mL) was added dropwise over a period of 1 hour under an atmosphere of nitrogen. The reaction mixture was stirred at room temperature for two hours, cooled in an ice-water bath, and quenched with dropwise addition of aqueous citric acid (80 mL, 1M). The mixture was concentrated under vacuum. The residue was partitioned between chloroform and saturated aqueous sodium bicarbonate. The organic extract was dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum. The residue was subjected to column chromatography on silica gel eluting with a gradient of 0-15% acetonitrile in chloroform. Collection and concentration of appropriate fractions provided the title compound. lH NMR (400 MHz, CDCI3) δ 4.46 (br s, IH), 4.24 (d, J = 18.4 Hz, 1 H), 3.78 (d, J = 18.4 Hz, 1 H),

3.64 (dd, J = 12.3, 4.2 Hz, 1 H), 3.54 (heptet, J = 7.1 Hz, 1 H), 3.38 (heptet, J = 7.1 Hz, 1 H), 2.99 (dd, J = 12.3, 1.8 Hz, 1 H), 1.47 (s, 9H), 1.21 (d, J = 6.8 Hz, 3H), 1.14 (t, J = 7.1 Hz, 3H). ES MS M+l = 243.

Step 4: (5S)-l-Ethyl-5-methylpiperazin-2-one hydrochloride Anhydrous hydrogen chloride gas was bubbled into a cold (-20 °C) solution of tert-butyl (2S)-4-ethyl-2-methyl-5-oxopiperazine-l-carboxylate (10.5 g, 43.4 mmol) in ethyl acetate (250 mL) under nitrogen. After the solution was saturated with hydrogen chloride, the reaction mixture was stirred in an ice-water bath for 30 minutes. The product mixture was purged with nitrogen, concentrated under vacuum to provide the title hydrogen chloride salt as pale yellow solid. lH NMR (400 MHz, DMSO-d6) δ 10.00 (br d, 2H), 3.72 (d, J = 16.6 Hz, 1 H), 3.62(d, J = 16.6 Hz, 1 H),

3.49-3.35 (m, 5 H), 3.29 (heptet, /= 7.3 Hz, 1 H), 1.31 (d, / = 6.6 Hz, 3H), 1.05 (t, J = 7.1 Hz, 3H).

Step 5: Ethyl (4S)-2-ethyl-8-hydroxy-4-methyl-l-oxo-l,2,3,4-tetrahydropyrrolo[l,2-a]pyrazin-7- carboxy late Anhydrous ammonia gas was bubbled into a cold (0 °C) solution of (5S)-l-Ethyl-5- methylpiperazin-2-one hydrochloride (5.8 g, 32.3 mmol) in chloroform for 30 minutes. The resultant slurry was filtered and concentrated under vacuum. The residual oil was concentrated as a solution in toluene under vacuum, redissolved in toluene (120 mL) and treated with diethyl ethoxymethylenemalonate (7.0 g, 32.3 mmol) and heated in a sealed flask in an oil bath at 100 °C overnight. The resultant solution was concentrated under vacuum. The residual oil was concentrated as a solution in toluene under vacuum to provide the corresponding diethyl { [(2S)-4-ethyl-2-methyl-5- oxopiperazin-l-yl]methylene}malonate. Without further purification, to a solution of the malonate (10.5 g, 33.5 mmol) in anhydrous THF (330 mL) warmed with an external oil bath at 65 °C under an atmosphere of nitrogen, a solution of lithium bis(trimethylsilyl)amide (35.1 mL, 1 M, 35.1 mmol) was added. The solution was heated at the same temperature for one hour and concentrated under vacuum. The residue was partitioned between dichloromethane and hydrochloric acid (1M). The organic extract was washed with brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under vacuum. The residue was triturated with diethyl ether. The solid precipitated was filtered, washed with diethyl ether to provide the title compound as pale brown solid. lH NMR (400 MHz, CDCI3) δ 8.43 (s, IH), 7.11 (s, IH), 4.32 (q, J = 7.1 Hz, 2H), 4.24 (m, IH), 3.65-

3.35 (m, 4H), 1.51 (d, J = 6.4 Hz, 3H), 1.36 (t, J = 7.0 Hz, 3H), 1.19 (t, J = 7.0 Hz, 3H). ES MS M+l = 267

Step 6: Ethyl (4S)-2-ethyl-8-methoxy-4-methyl-l-oxo-l,2,3,4-tetrahydropyrrolo[l,2-a]pyrazin-7- carboxylate A mixture of ethyl (4S)-2-ethyl-8-hydroxy-4-methyl-l -oxo- 1,2,3, 4-tetrahydropyrrolo[ 1,2- a]pyrazin-7-carboxylate (6.6 g, 24.8 mmol), anhydrous potassium carbonate (13.7 g, 99.1 mmol, 325 mesh), and iodomethane (4.2 g, 29.7 mmol) in anhydrous DMF (123 mL) was stirred at room temperature overnight. The mixture was filtered and concentrated under vacuum. The residue was partitioned between chloroform and dilute hydrochloric acid. The organic extract was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum. The residue was subjected to column chromatography on silica gel eluting with a gradient of 0-3% methanol in chloroform. Collection and concentration of appropriate fractions provided the title compound. Residual methanol was removed by concentrating from its solution in toluene under vacuum. lH NMR (400 MHz, CDCI3) δ 7.19 (s, IH), 4.29 (q, J = 7.1 Hz, 2 H), 4.24 (m, IH), 4.03 (s, 3H), 3.70-

3.32 (m, 4 H), 1.52 (d, J = 6.6 Hz, 3H), 1.35 (t, J = 7.0 Hz, 3H), 1.19 (t, J = 7.2 Hz, 3H). ES MS M+l = 281

Step 7: Ethyl (4S)-6-bromo-2-ethyl-8-methoxy-4-methyl-l-oxo-l,2,3,4-tetrahydropyrrolo[l,2- a]pyrazin-7-carboxylate To a mixture of ethyl (4S)-2-ethyl-8-(methoxy)-4-methyl-l-oxo-l,2,3,4- tetrahydropyrrolo[l,2- ]pyrazine-7-carboxylate (6.2 g, 22.1 mmol) and sodium bicarbonate (20.0 g, 238.0 mmol) in dichloromethane (500 mL) at 0 °C, a solution of bromine in dichloromethane (24.2 mmol, 0.5 M) was added over a period of 60 minutes. The reaction mixture was stirred at room temperature for 2 h, filtered, and concentrated under vacuum. The residue was subjected to column chromatography on silica gel eluted with ethyl acetate. Collection and concentration of appropriate fractions provided the corresponding bromide. Residual ethyl acetate was removed by concentrating from its solution in benzene under vacuum. lH NMR (400 MHz, CDCI3) δ 4.58 (br m, IH), 4.34 (m, IH), 3.99 (s, 3H), 3.92 (dd, J = 13.0, 4.0 Hz,

IH), 3.67 (heptet, J = 7.1 Hz, 1 H), 3.49 (heptet, J = 7.1 Hz, 1 H), 3.23 (d, J = 13.0 Hz, IH), 1.40 (d, J = 7.1 Hz, 3H), 1.38 (t, 7 = 7.0 Hz, 3H), 1.20 (t, J = 7.0 Hz, 3H). ES MS M+l = 359, 361.

Step 8: Ethyl (4S)-2-ethyl-8-(methoxy)-6-[methoxy(oxo)acetyl]-4-methyl-l-oxo-l,2,3,4- tetrahydropyrrolo[ 1 ,2- ]pyrazine-7-carboxylate To a cold (-78 °C) solution of ethyl (4S)-6-bromo-2-ethyl-8-methoxy-4-methyl-l-oxo- l,2,3,4-tetrahydropyrrolo[l,2-a]pyrazin-7-carboxylate (8.51 g, 23.7 mmol) in anhydrous THF (800 mL) under an atmosphere of dry nitrogen, a solution of n-BuLi in hexane (10.5 mL, 26.3 mmol, 2.5 M) was added. The resultant mixture was stirred at -78 °C for 20 minutes. A solution of dimethyl oxalate (6.4 g, 53.8 mmol; dried from concentration from benzene under vac) in anhydrous THF (30 mL) was added. The reaction mixture was stirred at -78 °C for 1 hour and cannulated into a mixture of aqueous sulfuric acid (240 mL, 2M) and THF (200 mL) maintained between at -5 to -35 °C. The mixture was extracted with ethyl acetate (3 times). The organic extracts were combined, washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The residue was subjected to column chromatography on silica gel eluted with 40 to 100% ethyl acetate- hexane gradient. Collection and concentration of appropriate fractions provided the titled compound. lH NMR (400 MHz, CDCI3) δ 5.07 (m, IH), 4.29 (q, J = 7.2 Hz, 2H), 4.00 (s, 3H), 3.99-3.93 (m, IH), 3.89 (s, 3H), 3.74-3.66 (m, IH), 3.53-3.48 (m, IH), 3.23 (dd, J = 1.3, 13.2 Hz, IH), 1.46 (d, J = 6.6 Hz, 3H), 1.36 (t, J = 7.2 Hz, 3H), 1.22 (t, 7= 7.1 Hz, 3H). ES MS M+l = 367

Step 9: (6S)-8-Ethyl-10-methoxy-6-methyl-l,9-dioxo-l,2,6,7,8,9- hexahydropyrazino[r,2′:l,5]pyrrolo[2,3-d]pyridazine-4-carbohydrazide A mixture of ethyl (4S)-2-ethyl-8-(methoxy)-6-[methoxy(oxo)acetyl]-4-methyl-l-oxo- l,2,3,4-tetrahydropyrrolo[l,2-α]pyrazine-7-carboxylate (3.3 g, 8.9 mmol) and anhydrous hydrazine (1.7 mL, 53.7 mmol) in methanol (400 mL) was stirred at room temperature for one hour. The reaction mixture was concentrated under vacuum. The residue was concentrated from toluene. The resultant gummy solid was treated with methanol (20 mL). Diethyl ether was added to the resultant slurry which was filtered to provide the title compound as white solid. lH NMR (400 MHz, CDCI3) δ 8.99 (br s, 2H), 5.54 (br m, IH), 4.12 (m, IH), 4.10 (s, 3H), 3.81 (m, IH),

3.39 (m, IH), 3.21 (d, 7 = 12.6 Hz, IH), 1.44 (d, 7 = 6.4 Hz, 3H), 1.23 (t, 7 = 7.3 Hz, 3H). ES MS M+l =

335

Step 10: (6S)-8-Ethyl-10-methoxy-N,6-dimethyl-l,9-dioxo-l,2,6,7,8,9- hexahydropyrazino[r,2′:l,5]pyrrolo[2,3-d]pyridazine-4-carboxamide To a solution of (6S)-8-ethyl-10-methoxy-6-methyl-l,9-dioxo-l,2,6,7,8,9- hexahydropyrazino[r,2′:l,5]pyrrolo[2,3-d]pyridazine-4-carbohydrazide (0.39 g, 1.2 mmol) and methylamine (5.9 mL, 11.8 mmol; 2 M in THF) in anhydrous dichloromethane (25 mL) in a water bath at room temperature, a solution of iodine (0.60 g, 2.4 mmol) in dichloromethane was added dropwise.

After the addition was completed, an aqueous solution of sodium sulfite was added and the mixture was stirred vigorously for 10 minutes. The organic phase was separated, diluted with chloroform, and washed with brine. The organic extract was dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum. The residue was triturated with a mixture of ethanol (7 mL) and diethyl ether (25 mL). The white solid precipitated was obtained by filtration and dried from its solution in toluene under vacuum. 1H NMR (400 MHz, CDCI3) δ 11.57 (s, IH), 7.38 (m, IH), 5.95 (br m, IH), 4.17 (s, 3H), 4.03 (dd, 7 =

13.4, 3.8 Hz, 1 H), 3.76 (heptet, 7 = 7.1 Hz, 1 H), 3.50 (heptet, 7 = 7.1 Hz, 1 H), 2.99 (dd, 7 = 12.9, 1.0 Hz, 1 H), 3.03 (d, 7 = 5.0 Hz, 3H), 1.44 (d, 7 = 6.6 Hz, 3H), 1.23 (t, 7 = 7.2 Hz, 3H). ES MS M+l = 334 Step 11: (6S)-2-(3-Chloro-4-fluorobenzyl)-8-ethyl-10-methoxy-N,6-dimethyl-l,9-dioxo- l,2,6,7,8,9-hexahydropyrazino[r,2′: l,5]pyrrolo[2,3-d]pyridazine-4-carboxamide To a cold (0 °C) solution of (6S)-8-ethyl-10-methoxy-N,6-dimethyl-l,9-dioxo- l,2,6,7,8,9-hexahydropyrazino[l’,2′: l,5]pyrrolo[2,3-d]pyridazine-4-carboxamide (1.58 g, 4.73 mmol) in anhydrous DMF (50 mL), a solution of lithium bis(trimethylsilyl)amide (4.97 mL, 4.97 mmol, 1 M in THF) was added. After stirring at the same temperature for 25 minutes, 3-chloro-4-fluorobenzyl bromide (1.27 g, 5.68 mmol) was added. The reaction mixture was stirred at room temperature for 10 minutes and concentrated under vacuum. The residue was partitioned between chloroform and brine. The organic extract was dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum. The residue was subjected to column chromatography on silica gel eluting with a 1-5% methanol in ethyl acetate gradient. Collection and concentration of appropriate fractions provided the title compound. lH NMR (400 MHz, CDCI3) δ 7.46 (dd, 7 = 6.9, 2.2 Hz, IH), 7.32 (m, IH), 7.09 (t, 7 = 7.6 Hz, IH), 7.03

(br signal, IH), 5.92 (m, IH), 5.32 (d, 7 = 14.1 Hz, IH), 5.26 (d, 7= 14.1 Hz, IH), 4.14 (s, 3H), 3.97 (dd, 7 = 13.2, 3.7 Hz, IH), 3.73 (heptet, 7 = 7.2 Hz, 1 H), 3.51 (heptet, 7 = 7.1 Hz, IH), 3.21 (dd, 7= 13.2, 1.7 Hz, IH), 3.03 (d, 7 = 5.0 Hz, 3H), 1.42 (d, 7 = 6.6 Hz, 3H), 1.23 (t, 7 = 7.1 Hz, 3H). ES MS M+l = 476

Step 12:

(6S)-2-(3-Chloro-4-fluorobenzyl)-8-ethyl-10-hydroxy-N,6-dimethyl-l,9-dioxo- l,2,6,7,8,9-hexahydropyrazino[r,2′:l,5]pyrrolo[2,3-d3pyridazine-4-carboxamide

To a solution of (6S)-2-(3-chloro-4-fluorobenzyl)-8-ethyl-10-methoxy-N,6-dimethyl-l,9- dioxo-l,2,6,7,8,9-hexahydropyrazino[r,2′:l,5]pyrrolo[2,3-d]pyridazine-4-carboxamide (1.15 g, 2.41 mmol) in anhydrous dichloromethane (800 mL), a solution of boron tribromide in dichloromethane (3.14 mL, 3.14 mmol; 1 M) was added. After stirring at room temperature for 5 minutes, the reaction mixture was treated with anhydrous methanol, stirred for 30 minutes, and concentrated under vacuum. The procedure was repeated twice. The residue was dissolved in a mixture of methanol and acetonitrile and treated with aqueous sodium hydroxide. The mixture was subjected to purification on preparative reverse phase high pressure column chromatography. Collection and lyophilization of appropriate fractions provided the title compound as white amorphous solid.

MK 2048

lH NMR (400 MHz, CDCI3) δ 7.48 (dd, 7 = 7.0, 2.2 Hz, IH), 7.33 (m, IH), 7.09 (t, 7 = 8.7 Hz, IH), 6.01 (m, IH), 5.33 (d, 7= 14.1 Hz, IH), 5.27 (d, 7 = 14.1 Hz, IH), 3.99 (dd, 7= 12.8, 4.0 Hz, 1 H), 3.71(heptet, 7 = 7.1 Hz, 1 H), 3.49 (heptet, 7 = 7.1 Hz, 1 H), 3.24 (dd, 7 = 13.2, 1.5 Hz, 1 H), 3.03 (d, 7 = 5.1 Hz, 3H), 1.42 (d, 7 = 6.6 Hz, 3H), 1.24 (t, 7 = 7.3 Hz, 3H). ES MS M+l = 462

The amorphous product was dissolved in boiling methanol (1.4 g/200 mL). Upon cooling in an ice-water bath, a precipitate formed which was separated by obtained by filtration to afford a white crystalline solid.

MK 2048sodium salt

The corresponding sodium salt was prepared by treatment of a solution of (6S)-2-(3- chloro-4-fluorobenzyl)-8-ethyl- 10-hydroxy-N,6-dimethyl-l ,9-dioxo- 1 ,2,6,7,8,9- hexahydropyrazino[r,2′:l,5]pyrrolo[2,3-d]pyridazine-4-carboxamide (920 mg, 1.99 mmol) in aqueous acetonitrile with aqueous sodium hydroxide (1.03 equivalent), followed by lyophilization of the resultant solution.

ChemSpider 2D Image | (5S)-1-Ethyl-5-methylpiperazin-2-on | C7H14N2O

(5S)-1-ethyl-5-methylpiperazin-2-one

 

 1,5-Cyclooctadiene-iridium(I) chloride dimer, Chloro(1,5-cyclooctadiene)iridium(I) dimer, Di-μ-chlorobis[(1,2,5,6-η)-1,5-cyclooctadiene]diiridium, Iridium(I) chloride 1,5-cyclooctadiene complex dimer, [Ir(1,5-cod)Cl]2, [Ir(1,5-cod)Cl]2, [Ir(cod)Cl]2

 

(S)-1-[(R)-2-Di-(4-methoxy-3,5-dimethylphenyl-phosphino)ferrocenyl]-ethyl-dicyclohexylphosphine

SL-J006-2


 

(5S)-l-Ethyl-5-methylpiperazin-2-one was alternatively prepared as follows:

Step 1: N^rf-Butoxycarbonyl-N^ethylglycinamide Ethylamine (37 g, 0.82 mol) was condensed into a pressure vessel at 0 °C. N-(tert- butoxycarbonyl)glycine methyl ester (50 mL, 0.34 mol) was added. The vessel was sealed and the mixture was stirred at room temperature overnight. The product mixture was concentrated under vacuum and the residue was passed through a pad of silica gel eluting with ethyl acetate. The solution was concentrated under vacuum to provide the title compound as a clear oil. lH NMR (400 MHz, CDCI3) δ 6.11 (br s, IH), 5.18 (br s, IH), 3.77 (d, 7 = 5.7 Hz, 2H), 3.31 (q, 7 = 7.1

Hz, 2H), 1.15 (t, 7 = 7.1 Hz, 3H).

Step 2: l-Ethyl-5-methylpyrazin-2(lH)-one A cold (0 °C) solution of N^tø^butoxycarbonyl-N^ethylglycinamide (68.0 g, 0.33 mol) in anhydrous dichloromethane (500 mL) was saturated with anhydrous hydrogen chloride gas. After stirring at the same temperature for 1.5 hours, the solution was recharged with more hydrogen chloride gas and stirred for additional 15 minutes. The reaction mixture was concentrated under vacuum. The residue was dissolved in methanol, diluted with toluene, and concentrated under vacuum to afford the intermediate N-ethylglycinamide HCI salt.

This was stored under vacuum overnight and used without further purification. A solution of N-ethylglycinamide HCI salt (44.2 g, 0.32 mol), aqueous sodium hydroxide (640 mL, 1M), water (350 mL), pyruvic aldehyde (20.9 mL, 40% solution in water) was heated in an oil bath at 120 °C for one hour. The reaction mixture was cooled and saturated with solid sodium chloride. The mixture was extracted with chloroform (4×250 mL).

The combined organic extract was dried over anhydrous sodium sulfate, filtered, and passed through a plug of silica gel. The silica gel was rinsed successively with ethyl acetate and then 2% methanol in ethyl acetate. The eluted fractions were combined and concentrated under vacuum. The residual solid was recrystallized from diethyl ether to afford the title compound as pale yellow solid. lH NMR (400 MHz, CDCI3) δ 8.11 (s, IH), 6.92 (s, IH), 3.92 (q, 7 = 7.2 Hz, 2H), 2.28 (s, 3H), 1.37 (t, 7 = 7.2 Hz, 3H).

Step 3: (5 S)- 1 -Ethyl-5-methylpiperazin-2-one

A mixture of chloro-l,5-cyclooctadiene iridium (I) dimer (34 mg, 51 μmol) and (S)-l-[(R)-2-di-(3,5-bis(trifluoromethyl)phenyl)phosphino)ferrocenyl]ethyldicyclohexylphosphine (44 mg, 51 μmol; Solvias AG, SL-J006-2) in a mixture of 1:2 toluene and methanol (100 mL; purged with nitrogen for 15 minutes) was sonicated under an atmosphere of nitrogen for 15 minutes. To the resultant mixture, iodine (0.39 g, 1.52 mmol) and l-ethyl-5-methylpyrazin-2(lH)-one (7.0 g, 50.66 mmol) was added. The resultant mixture was heated in an oil bath at 50 °C under an atmosphere of hydrogen gas at 800 psi for 48 hours. The product mixture was filtered through a pad of Celite. The filtrate was concentrated under vacuum. The residue was treated with chloroform saturated with ammonia gas (100 mL). The resultant suspension was filtered through a pad of Celite, which was the rinsed with chloroform saturated with ammonia gas. The combined filtrate was concentrated under vacuum. The residue was concentrated as a solution in toluene for subsequent reaction. lH NMR (400 MHz, CDCI3) δ 3.58 (d, 7 = 17.2 Hz, IH), 3.53(d, 7 = 17.2 Hz, IH), 3.49-3.35 (m, 2H),

1.19 (d, 7 = 5.9 Hz, 3H), 1.14 (t, 7 = 7.2 Hz, 3H).



……………..

US 7538112

http://www.google.com/patents/US7538112

Step 12: (6S)-2-(3-Chloro-4-fluorobenzyl)-8-ethyl-10-hydroxy-N,6-dimethyl-1,9-dioxo-1,2,6,7,8,9-hexahydropyrazino[1′,2′:1,5]pyrrolo[2,3-d]pyridazine-4-carboxamide

To a solution of (6S)-2-(3-chloro-4-fluorobenzyl)-8-ethyl-10-methoxy-N,6-dimethyl-1,9-dioxo-1,2,6,7,8,9-hexahydropyrazino[1′,2′:1,5]pyrrolo[2,3-d]pyridazine-4-carboxamide (1.15 g, 2.41 mmol) in anhydrous dichloromethane (800 mL), a solution of boron tribromide in dichloromethane (3.14 mL, 3.14 mmol; 1 M) was added. After stirring at room temperature for 5 minutes, the reaction mixture was treated with anhydrous methanol, stirred for 30 minutes, and concentrated under vacuum. The procedure was repeated twice. The residue was dissolved in a mixture of methanol and acetonitrile and treated with aqueous sodium hydroxide. The mixture was subjected to purification on preparative reverse phase high pressure column chromatography. Collection and lyophilization of appropriate fractions provided the title compound as white amorphous solid.

1H NMR (400 MHz, CDCl3) δ 7.48 (dd, J=7.0, 2.2 Hz, 1H), 7.33 (m, 1H), 7.09 (t, J=8.7 Hz, 1H), 6.01 (m, 1H), 5.33 (d, J=14.1 Hz, 1H), 5.27 (d, J=14.1 Hz, 1H), 3.99 (dd, J=12.8, 4.0 Hz, 1 H), 3.71 (heptet, J=7.1 Hz, 1 H), 3.49 (heptet, J=7.1 Hz, 1 H), 3.24 (dd, J=13.2, 1.5 Hz, 1 H), 3.03 (d, J=5.1 Hz, 3H), 1.42 (d, J=6.6 Hz, 3H), 1.24 (t, J=7.3 Hz, 3H). ES MS M+1=462

The amorphous product was dissolved in boiling methanol (1.4 g/200 mL). Upon cooling in an ice-water bath, a precipitate formed which was separated by obtained by filtration to afford a white crystalline solid.

The corresponding sodium salt was prepared by treatment of a solution of (6S)-2-(3-chloro-4-fluorobenzyl)-8-ethyl-10-hydroxy-N,6-dimethyl-1,9-dioxo-1,2,6,7,8,9-hexahydropyrazino[1′,2′:1,5]pyrrolo[2,3-d]pyridazine-4-carboxamide (920 mg, 1.99 mmol) in aqueous acetonitrile with aqueous sodium hydroxide (1.03 equivalent), followed by lyophilization of the resultant solution.

 

References

  1.  Keith Alcorn. Ralvetgravir shows potential for use as PrEP drug AIDSmap.com. 28 April 2009. Accessed 8 Nov 2009.
  2. Mark Mascolini. Merck Offers Unique Perspective on Second-Generation Integrase Inhibitor. 10th International Workshop on Clinical Pharmacology of HIV Therapy, April 15–17, 2009, Amsterdam. Accessed 8 Nov 2009.
WO2011121105A1 1 Apr 2011 6 Oct 2011 Tibotec Pharmaceuticals Macrocyclic integrase inhibitors
EP1756114A2 * 3 May 2005 28 Feb 2007 Merck and Co., Inc. Hiv integrase inhibitors
US7517929 3 Dec 2004 14 Apr 2009 Momentive Performance Materials Inc. Star-branched silicone polymers as anti-mist additives for coating applications

 

US5693640 * 6 Jun 1995 2 Dec 1997 Merck, Sharp & Dohme, Ltd. Pyridazino-indole derivatives
US5756501 * 3 Dec 1996 26 May 1998 American Home Products Corporation Saturated and unsaturated pyridazino 4,5-B! indolizines useful as antidementia agents

Valnemulin


Pleuromutilin skeletal.svg

Valnemulin

101312-92-9,

(3aS,4R,5S,6S,8R,9R,9aR,10R)-6-ethenyl-
5-hydroxy-4,6,9,10-tetramethyl-1-oxodecahydro-
3a,9-propano-3aH-cyclopenta[8]annulen-8-yl-
[(R)-2-(2-amino-3-methylbutanoylamino)-1,1-dimethtylethyl
sulfanyl]acetate

[[2-[(R)-2-Amino-3-methylbutyramido]-1,1-dimethylethyl]thio]acetic acid (3aS,4R,5S,6S,8R,9R,9aR,10R)-decahydro-5-hydroxy-1-oxo-4,6,9,10-tetramethyl-6-vinyl-3a,9-propano-3aH-cyclopentacycloocten-8-yl ester

 Econor, Valnemulin [INN], AC1L2SMW, UNII-2AHC415BQG, 101312-92-9, FT-0675767
Molecular Formula: C31H52N2O5S   Molecular Weight: 564.81998

launched 1999 novartis for bacterial infection

 

Valnemulin (trade name Econor) is a pleuromutilin antibiotic used to treat swine dysenteryileitiscolitis and pneumonia. It is also used for the prevention of intestinal infections of swine.[1] Valnemulin has been observed to induce a rapid reduction of clinical symptoms ofMycoplasma bovis infection, and eliminate M. bovis from the lungs of calves.[2]

 

Pleuromutilin, a compound of formula

 

Figure US08088823-20120103-C00001

is a naturally occurring antibiotic, e.g. produced by the basidomycetes Pleurotus mutilus and P. passeckerianus, see e.g. The Merck Index, 12th edition, item 7694.

 

A number of further pleuromutilins having the principle ring structure of pleuromutilin and having e.g. antibacterial activity, have been developed.

A pleuromutilin of the present invention includes a pleuromutilin having the basic structural elements as set out in formula

 

Figure US08088823-20120103-C00002

wherein R is vinyl or ethyl and the dotted line is a bond or is no bond.

 

The following numbering system is used in the present application:

 

Figure US08088823-20120103-C00003

 

The dotted line between positions 19 and 20 (and between positions 1 and 2) is a bond or is no bond. In a compound of formula A or of formula PLEU a hydrogen atom in positions 4, 7 and/or 8 of the ring system may be replaced by deuterium, and if the dotted line between positions 1 and 2 is no bond (single bond between positions 1 and 2) the ring system may be further substituted in positions 1 and/or 2, e.g. by halogen, deuterium or hydroxy. The group —O— in position 14 is further substituted, preferably by a substituted carbonyl group.

Examples of pleuromutilins according to the present invention includes e.g.

    • A compound as disclosed in U.S. Pat. No. 3,716,579, e.g. of formula

 

Figure US08088823-20120103-C00004

 

  • wherein R is CH3—(CH2)7—CH═CH—(CH2)7—COO—, CH3—(CH2)4—CH═CH—CH2—CH═CH—(CH2)7—COO—, CH3—(CH2)9—CH═CH—(CH2)7—COO— or hydrogen;
    • A compound as disclosed in GB1312148, e.g. of formula

 

Figure US08088823-20120103-C00005
14-Desoxy-14[(2-diethylaminoethyl)mercaptoacetoxy]mutilin, e.g. also known as tiamulin of formula 

Figure US08088823-20120103-C00008

 

    • A compound as disclosed in U.S. Pat. No. 4,130,709, e.g. of formula

 

Figure US08088823-20120103-C00009
    • A compound as disclosed in U.S. Pat. No. 4,129,721; e.g. of formula

 

Figure US08088823-20120103-C00010

and the 19,20-dihydro derivative thereof and the tetra(C2-6)alkanoyl derivatives thereof;

 

    • A compound as disclosed in EP0013768, e.g. of formula

 

Figure US08088823-20120103-C00011

 

    • A compound as disclosed in EP0153277, e.g. an N-acyl-14-O-[(1-amino-2-methylpropan-2-yl)thioacetyl]-mutilin or 19,20-dihydromutilin, such as of formula

 

Figure US08088823-20120103-C00012

wherein Ris vinyl or ethyl positions 19 and 20), and Ris optionally hydroxy-substituted aminoalkyl or a 5-membered saturated heterocycle, e.g. including Valnemulin (Econor®) of formula

 

 

Figure US08088823-20120103-C00013

 

    • A compound as disclosed in U.S. Pat. No. 516,526, e.g. of formula

 

Figure US08088823-20120103-C00014

wherein Rand Rindependently of each other are H, alkyl, alkenyl, cycloalkyl, aryl or aralkyl;

 

    • A compound as disclosed in WO9322288, e.g. of formula

 

Figure US08088823-20120103-C00015

wherein Rand Rare independently of each other H, alkyl, or, Rand Rtogether with the carbon atom to which they are attached are cycloalkyl; and Rand Rindependently of each other are H, alkyl or substituted alkyl;

 

    • A compound as disclosed in WO9725309, e.g. of formula

 

Figure US08088823-20120103-C00016

wherein Y is carbamoyloxy, wherein the N-atom is unsubstituted or mono- or disubstituted, such as a compound of formula

 

 

Figure US08088823-20120103-C00017

see more at……..

    • A compound as disclosed in EP0153277, e.g. an N-acyl-14-O-[(1-amino-2-methylpropan-2-yl)thioacetyl]-mutilin or 19,20-dihydromutilin, such as of formula

 

Figure US08088823-20120103-C00012

wherein Ris vinyl or ethyl positions 19 and 20), and Ris optionally hydroxy-substituted aminoalkyl or a 5-membered saturated heterocycle, e.g. including Valnemulin (Econor®) of formula

 

 

Figure US08088823-20120103-C00013

 

    • A compound as disclosed in U.S. Pat. No. 516,526, e.g. of formula

 

Figure US08088823-20120103-C00014

wherein Rand Rindependently of each other are H, alkyl, alkenyl, cycloalkyl, aryl or aralkyl;

 

    • A compound as disclosed in WO9322288, e.g. of formula

 

Figure US08088823-20120103-C00015

wherein Rand Rare independently of each other H, alkyl, or, Rand Rtogether with the carbon atom to which they are attached are cycloalkyl; and Rand Rindependently of each other are H, alkyl or substituted alkyl;

 

    • A compound as disclosed in WO9725309, e.g. of formula

 

Figure US08088823-20120103-C00016

wherein Y is carbamoyloxy, wherein the N-atom is unsubstituted or mono- or disubstituted, such as a compound of formula

 

 

Figure US08088823-20120103-C00017

see more at…………….http://www.google.com/patents/US8088823

  • Valnemulin is known from EP-0.153.277 and is described specifically therein in example 12.
    Valnemulin is also known by the commercial name Econor®.
  • As is generally known, this compound has antibacterial properties, e.g. following oral or parenteral administration, and is used for the prevention or cure of a series of bacterial infections in the field of animal health. The broad spectrum of activity includes Streptococcus aronson, Staphylococcus aureusMycoplasma arthritidis, Mycoplasma bovigenitalium, Mycoplasma bovimastitidis, Mycoplasma bovirhinis,Mycoplasma sp., Mycoplasma canis, Mycoplasma felis, Mycoplasma fermentans, Mycoplasma gallinarum, Mycoplasma gallisepticum, A. granularum, Mycoplasma hominis, Mycoplasma hyorhinis,Actinobacillus laidlawii, Mycoplasma meleagridis, Mycoplasma neurolyticum, Mycoplasma pneumonia und Mycoplasma hyopneumoniae.
  • WO 98/01127 describes its excellent activity against an illness complex that can arise whenever animals are kept in a very restricted space (increased stocking density) e.g. for transport purposes, and are thus exposed to great stress. The most frequent pathogens that play a decisive role in this instance are Mycoplasma hyopneumoniae, Serpulina(formerly Treponemahyodysenteriae, Serpulina pilosicoli, Lawsonia intracellularis, Mycoplasma gallisepticum, Pasteurella multocida, Actinobacillus (Haemophiluspleuropneumoniae and Haemophilus parasuis, whereby diseases of the respiratory tract and other infections often occur together and lead to a complex clinical picture. All herd animals are affected, e.g. cattle, sheep and pigs, but also poultry.
  • In its free form (valnemulin base), valnemulin is relatively unstable and is therefore primarily used in the form of its salts, particularly as the hydrochloride. A current method of administering antibiotics in the field of animal health is the injection, since it is suitable for administering a controlled single dose and thus a quantity tailored to individual needs. This is often crucial to successful control of many infectious diseases in the field of animal medicines. In contrast, oral administration cannot be controlled nearly so well, and is more customary in human medicine.
  • However, it has been shown that aqueous injection solutions and even oily injection suspensions of the salts of valnemulin are poorly tolerated by most domestic animals and in particular by pigs. Damage ranging from mild skin irritation to poorly healing necroses, has been observed. This is also one of the reasons that valnemulin has mainly been used orally until now. In addition, aqueous solutions usually do not show the desired depot action. A further problem is that valnemulin cannot be produced in technical quantities in the free form, as the so-called valnemulin base, but occurs as the salt, and has therefore been used for therapy as the salt.

………………………………….

syn

http://www.google.com/patents/CN102675173B?cl=en

valnemulin hydrochloride (Valnemulin hydrochloride) chemical name: [[2_ [[(2R) _2_ amino-3 – methyl-1 – oxobutyl] amino] -1,1 – dimethyl- ethyl] thio] acetic acid (3aS, 4R, 5S, 6S, 8R, 9R, 9aR, I OR) -6 – vinyl-decahydro-5 – hydroxy -4,6,9,10 – tetramethyl-1 – oxo _3a, 9 – propanol _3aH_ cyclopenta cyclooctene en-8 – yl ester hydrochloride, the chemical structure of formula I as shown. A molecular weight of 601.28, as a white amorphous powder characters have strong hygroscopicity, soluble in water, ethanol, methyl tert-butyl ether in almost insoluble, mp 174-177Ό.

 

Figure CN102675173BD00031

Valnemulin hydrochloride is a new generation of pleuromutilins semi-synthetic antibiotics, are two terpenes, and tiamulin belong to the same class of drugs that are animal-specific antibiotics. Mainly used for prevention and treatment of pigs, cattle, sheep and poultry mycoplasma disease and Gram-positive bacterial infections. 1999 by the European Commission approved for the prevention and treatment of swine dysentery swine dysentery infection caused by the spirochete short and swine enzootic pneumonia caused by the Mycoplasma pneumoniae infection is the first Europe-wide approval of veterinary drugs premixes, is as a veterinary prescription drugs. September 9, 2010, approved by the Ministry of Agriculture Bulletin No. 1457 of Valnemulin hydrochloride developed materials and premixes for the state Department of Agriculture approved new animal drug II. Therefore, in our veterinary clinic has broad application prospects.

 Chemical synthesis of hydrochloric Valnemulin has a lot of literature. Most of which are to pleuromutilins as raw material, p-toluenesulfonyl chloride sulfonation reaction with dimethyl cysteamine hydrochloride, and then protected with an amino group, a carboxyl group is activated D-valine reaction, the final hydrolysis Valnemulin hydrochloride.

Chinese patent discloses a method for preparing CN102225905A Valnemulin hydrochloride method, which is after the Pleuromutilin reacted with tosyl chloride, after 1 – amino-2 – methyl-2 – thiolate substituted acid to give (2 – amino-1 ,1 – dimethylethyl) thio] acetic acid (3aS, 4R, 5S, 6S, 8R, 9R, 9aR, 10R) -6 – vinyl decahydro _5_ hydroxy -4,6,9,10 – tetramethyl-1 – oxo-3a, 9 – propanol _3aH_ cyclopenta cyclooctene – (4H) -8 spare ester; other with D- valine methyl acetoacetate and the reaction with chloroacetic acid anhydride as isobutyl, and then with (2 – amino-1 ,1 – dimethylethyl) thio] acetic acid (3aS, 4R, 5S, 6S, 8R , 9R, 9aR, I OR) -6 – vinyl decahydro-5 – hydroxy -4,6,9,10 – tetramethyl _1_ oxo _3a, 9 – propanol _3aH_ garrison diene ring and cyclooctene – (4H) -8 ester amide hydrochloride later deprotected valnemulin hydrochloride was obtained, with ether as the solvent for this process, morpholine catalyst. In this line, the spent acid to activate Dioxide valine carboxy, increasing the difficulty of activation, and in the last reaction step using ether as the solvent, low-boiling inflammable volatile ether, in the operation increased risk. [0007] Chinese patent CN101318921A also opened a method for preparing Valnemulin, comprising the following steps: (1) preparation of chlorinated Pleuromutilin: to Pleuromutilin as raw materials, the reaction with HCl, convert it to Chloride pleuromutilin; (2) Preparation of N-allyloxycarbonyl group of valine: valine as starting material, which was reacted with allyl chloroformate to obtain N-protected amino group is allyloxycarbonyl group valine; (3) 1,1 – dimethyl-2 – Preparation of (N-allyloxycarbonyl group valinamido) ethanethiol: N-allyloxycarbonyl group of valine obtained acid chloride with oxalyl chloride and _ chloride with 1,1-dimethyl-2 – aminoethanethiol intermediate obtained by reacting 1,1 – dimethyl -2 – (N-allyloxycarbonyl group valinamido) ethanethiol; (4) Preparation of valnemulin of: 1,1 – dimethyl -2 – (N-allyloxycarbonyl group valinamido) reaction with ethanethiol pleuromutilins chloride to obtain an amino protected valnemulin In palladium catalyzed hydrogenation of carbon was going to protect Valnemulin. The disadvantage of this method is the use of a pleuromutilin in the chloride solution of HCl in methanol, increased corrosion of the equipment; allyl protecting group removal in the spent catalyst is palladium on carbon, palladium on carbon is too high and difficult recovery rates , thereby increasing the cost of the final product.

Starting materials Pleuromutilin by higher fungi Basidiomycetes Pleurotus a strain produced by submerged culture mainly against Gram-positive bacteria and mycoplasma active antimicrobial substances. As a semi-synthetic precursor substance, its content and impurities have a significant impact on the synthesis of hydrochloric acid Valnemulin quality standards. Recrystallization can effectively remove impurities and improve the content, thus effectively simplify the purification process to remove impurities and hydrochloric La Vergne wonderful forest to provide a guarantee from the source.

Figure CN102675173BD00041

 

 Example 1:

 A Valnemulin hydrochloride chemical synthesis method, as follows:

 (I) purified pleuromutilin

[0021] 250g of pleuromutilin first dissolved in methyl tert-butyl ether 2000mL stirred solution clear. Activated carbon was then added 50g, stirred for 3 h at room temperature decolorization, activated carbon was filtered off and the filtrate was concentrated to about 500mL heating when a large number of crystal precipitation, heating was stopped, cooled to room temperature and stirring was continued for 4h. After the crystals were centrifuged and dried to obtain fine pleuromutilin 220g (yield 88%).

 

 

References

  1.  Econor: Product Profile
  2.  Stipkovits, L.; Ripley, P.; Tenk, M.; Glávits, R.; Molnár, T.; Fodor, L. (2005). “The efficacy of valnemulin (Econor) in the control of disease caused by experimental infection of calves with”. Research in Veterinary Science 78 (3): 207–215. doi:10.1016/j.rvsc.2004.09.005.PMID 15766939. 

 

US4278674 Nov 29, 1979 Jul 14, 1981 Sandoz Ltd. Substituted 14-desoxy-mutilin compositions
US4517178 * Jun 13, 1983 May 14, 1985 Rikagaku Kenkyusho Novel antibiotic 76-11, process for the production thereof, anticoccidiosis agent and domestic animals growth accelerator comprising the same as an effective ingredient
US7534814 * Jun 14, 2004 May 19, 2009 Nabriva Therapeutics Ag Mutilin derivatives and their use as antibacterials
US20050159377 Jun 16, 2004 Jul 21, 2005 Smithkline Beecham Corporation Methods of modulating activity of prokaryotic ribosomes
EP0013768A1 Dec 31, 1979 Aug 6, 1980 Sandoz Ag New pleuromutilin derivatives, their production and pharmaceutical compositions containing them
WO2000071560A1 May 4, 2000 Nov 30, 2000 Lisa Anne Hegg Methods of modulating activity of prokaryotic ribosomes
WO2002012199A1 Aug 2, 2001 Feb 14, 2002 Steven Aitken Heterocyclic mutilin esters and their use as antibacterials
WO2002022580A1 Sep 11, 2001 Mar 21, 2002 Gerd Ascher Antibacterials mutilins

BC-7013 a Topical pleuromutilin antibiotic agent from Nabriva


Antibiotics 02 00500 i026

BC-7013 (topical)

[14-O-[(3-Hydroxymethyl-phenylsulfanyl)-acetyl]-mutilin]

Pleuromutilins

Nabriva

Gram-positive

poster……….https://jmilabs.com/data/posters/ICAAC2009/F1-1521.pdf

BC7013 [14-O-[(3-Hydroxymethyl-phenylsulfanyl)-acetyl]-mutilin] is a novel semi-synthetic pleuromutilin derivative that inhibits prokaryotic protein synthesis.

Pleuromutilins were discovered as natural-product antibiotics in 1950. Tiamulin was the first pleuromutilin compound to be approved for veterinary use in 1979, followed by valnemulin in 1999. It was not until 2007 that retapamulin became the first pleuromutilin approved for use in humans. However, retapamulin is limited to topical application. Recent advances in lead optimization have led to the synthesis of pleuromutilins that combine potent antibacterial activity with favorable pharmaceutical properties, making these compounds suitable for oral and intravenous delivery. Most pleuromutilins have an antibacterial spectrum that spans the common pathogens involved in both skin and respiratory tract infections. Two new pleuromutilins, BC-3205 and BC-7013 (both Nabriva Therapeutics AG), have entered clinical trials. In this review, the key properties of pleuromutilin derivatives, designed primarily through modifications at the C(14) side chain, are presented, and the potential of these compounds in systemic therapy in humans is discussed.

Discovered in 1959, pleuromutilins have the potential to be developed as a new class of antibiotics for systemic use in humans. Although in 2007 retapamulin became the first pleuromutilin approved for topical use in humans, it was not until 2011 that a pleuromutilin antibiotic, BC‑3781, was tested successfully in a Phase 2 clinical trial for systemic use in patients.

BC‑7013 belongs to a series of proprietary Nabriva pleuromutilins, which have been designed by Nabriva’s medicinal chemists to fulfill the specific requirements of a topical antibacterial agent. The clinical study is designed to evaluate safety and tolerability of BC‑7013.

In recent years, bacterial infections resistant to most forms of current antibiotics have appeared throughout the world and are currently the third leading cause of death in the US and Western Europe. Pleuromutilins represent a new class of antibiotics, inhibiting bacterial protein synthesis by binding to unique sites on the 50S subunit of the ribosome. These new antibiotics have two distinct advantages: they have a very low potential for cross-resistance with other established antibacterial classes and display a very low potential for resistance development.

“This is the second pleuromutilin antibiotic Nabriva has moved into clinical trials since our inception 18 months ago, emphasising our view of the potential of this new antibiotic class”, said Rodger Novak, Chief Operating Officer of Nabriva.

Nabriva’s first pleuromutilin program to enter the clinic, BC‑3205, is an oral agent with activity against gram positive and gram negative bacteria and atypicals. BC‑3205 is currently in a multi-dose Phase 1 trial.

Pleuromutilin antibiotics are a novel clinically validated class of antibiotics that specifically inhibit bacterial protein synthesis. Their antibacterial profile covers resistant pathogens, including MRSA, that cause diseases such as respiratory tract and skin infections.

Nabriva Therapeutics’ pleuromutilins are unique antimicrobial compounds that interfere with bacterial protein synthesis via a specific interaction with the 23S rRNA of the 50S bacterial ribosome subunit. These antibacterials have a distinct anti-bacterial profile. Their unique mechanism of action implies a very low probability of cross resistance with other antibacterials. In an industry first, Nabriva’s world class medicinal chemistry expertise achieved the development of intravenous and orally available pleuromutilins clearing the way for i.v. and oral therapy with this antibiotic class. This achievement constitutes a significant milestone in providing appropriate medication for the treatment of life-threatening bacterial infections offering a distinctly different class of antibiotics for the treatment of bacterial diseases.

  • New class of antibiotics on the human market
  • High target specificity plus a unique mode of action ensures differentiation from existing antibiotic classes and compounds in development
  • Very low propensity for resistance development
  • Accessibility to both Gram-positive & Gram-negative ribosomes translates into broad spectrum activity against a wide range of infections
  • Excellent safety profile
  • Oral, intraveneous and topical delivery

Nabriva is the first company with proof of concept achieved for the systemic use of pleuromutilins in patients. Two new pleuromutilins, BC‑3781 and BC‑7013, from Nabriva have shown excellent results in clinical studies. BC‑3781 is about to enter Phase 3. Since Nabriva´s pleuromutilin antibiotics have an ideal anti-bacterial spectrum for both skin and respiratory infections and are available as both oral and i.v. formulations, they address a significant medical need and constitute an excellent commercial opportunity.

mutilins

Mutilin is minor metabolite of the pleuromutilin family, originally isolated from Pleurotus mutilus. Mutilin is formed by hydrolysis of the hydroxyacetyl ester of pleuromutilin, and is a degradation product and in vivo metabolite of

pleuromutilin. Interest in mutilin has focused on its potential as a substrate for generating unique metabolites via
biosynthesis to provide a broader range of targets for semi-synthetic modification.

pleuromutilin

Pleuromutilin skeletal.svg

 

 

Nabriva. Pleuromutilins. Available online: http://www.nabriva.com/programs/pleuromutilins/ (accessed on 7 December 2012).

Novak, R. Are pleuromutilin antibiotics finally fit for human use? Ann. NY Acad. Sci. 20111241, 71–81, doi:10.1111/j.1749-6632.2011.06219.x.

Ranbezolid from Ranbaxy as an oxazolidinone antibacterial


Ranbezolid structure.svg

Ranbezolid

392659-39-1 hydrochloride

392659-38-0 (free base)

N-{[(5S)-3-(3-Fluoro-4-{4-[(5-nitro-2-furyl)methyl]-1-piperazinyl}phenyl)-2-oxo-1,3-oxazolidin-5-yl]methyl}acetamide

(S)-N-[[3-fluoro-4-[N-1[4-{2-furyl-(5-nitro)methyl}]piperazinyl]-phenyl]-2-oxo-5-oxazolidinyl]-methyl]acetamide

AC1LAX1P,  RBx7644 (*Hydrochloride*),RBx-7644
Molecular Formula: C21H24FN5O6   Molecular Weight: 461.443563
Ranbaxy Lab Ltd  ORIGINATOR
Ranbezolid is a novel oxazolidinone antibacterial. It competitively inhibits monoamine oxidase-A (MAO-A).[1]

Infections due to Gram-positive bacteria such as methicillin-resistant Staphylococcus aureus (MRSA), vancomycin-resistant Enterococcus faecium (VRE), and penicillin-resistant Streptococcus pneumoniae(PRSP) are the leading cause of morbidity and mortality in hospital settings and community today. Oxazolidinones are a new class of totally synthetic antibacterial agents active against Gram-positive infections. Linezolid  (Zyvox™, Pharmacia/Pfizer,  is a drug in this class, approved in the United States and Europe for treatment of Gram-positive nosocomial and community-acquired pneumoniae and skin infections. Oxazolidinones inhibit the bacterial protein synthesis prior to the chain initiation step, by binding to the 23S rRNA of 50S ribosomal subunit, and interfering with the initiator fMet–tRNA binding to the P-site of the ribosomal peptidyltransferase centre

 

 

Ranbezolid hydrochloride, RBx-7644

9-23-2005
Plymorphic forms of phenyl oxazolidinone derivatives

The title compound is prepared by reductive alkylation of the known piperazinyl oxazolidinone derivative (I) with 5-nitro-2-furfural (II) in the presence of NaBH(OAc)3, followed by conversion to the corresponding hydrochloride salt.

EP 1303511; US 2002103186; WO 0206278; WO 0307870; WO 0308389

…………….

synthesis

The antibacterial activity of RBx-7644 is due to the 5(S)-acetamidomethyl configuration at the oxazolidinone ring, and thus, asymmetric synthesis of only the 5(S)-enantiomer was desirable: 3,4-Difluoronitrobenzene (I) is condensed with piperazine in acetonitrile to give 4-(2-fluoro-4-nitrophenyl)-piperazine (II) as a light yellow compound. Compound (II) is dissolved in dichloromethane and triethylamine, followed by the addition of Boc-anhydride, to provide compound (III). 4-(tert-Butoxycarbonyl)-1-(2-fluoro-4-nitrophenyl)piperazine (III), upon hydrogenation with H2 over Pd/C in methanol at 50 psi, yields 4-(tert-butoxycarbonyl)-1-(2-fluoro-4-aminophenyl)piperazine (IV) as a dark solid. Compound (IV) reacts with benzylchloroformate in dry THF in the presence of solid sodium bicarbonate to afford the desired compound (V). 4-(tert-Butoxycarbonyl)-1-[2-fluoro-4-(benzyloxycarbonylamino)phenyl]piperazine (V), upon treatment with n-BuLi and (R)-glycidyl butyrate at -78 癈, gives the desired (R)-(-)-3-[3-fluoro-4-[4-(tert-butoxycarbonyl)piperazin-1-yl]phenyl]-5-(hydroxymethyl)-2-oxazolidinone (VI). The hydroxymethyl compound (VI) is treated with methanesulfonyl chloride in dichloromethane in the presence of triethylamine to give (R)-(-)-3-[3-fluoro-4-[4-(tert-butoxycarbonyl)piperazin-1-yl]phenyl]-5-(methylsulfonyloxymethyl)-2-oxazolidinone (VII). The sulfonyl derivative (VII) is treated with sodium azide in dimethylformamide to provide the azide (VIII) as a white solid. (R)-(-)-3-[3-Fluoro-4-[4-(tert-butoxycarbonyl)piperazin-1-yl)phenyl]-5-(azidomethyl)-2-oxazolidinone (VIII), upon hydrogenation with H2 over Pd/C at 45 psi, gives (S)-(-)-3-[3-fluoro-4-[4-(tert-butoxycarbonyl)-piperazin-1-yl]phenyl]-5-(aminomethyl)-2-oxazolidinone (IX). The aminomethyl compound (IX), upon treatment with acetic anhydride in dichloromethane in the presence of triethylamine, affords the acetamide derivative (X). The acetamidomethyl-oxazolidinone derivative (X), upon treatment with trifluoroacetic acid, gives (S)-(-)-3-[3-fluoro-4-(1-piperazinyl)phenyl]-5-(acetamidomethyl)-2-oxazolidinone, which, without isolation, is treated with 5-nitro-2-furaldehyde in the presence of sodium triacetoxy borohydride to provide compound (XI). Compound (XI), upon treatment with ethanolic HCl, affords RBx-7644 as a light yellow crystalline solid.

 

………………….

polymorphs

http://www.google.com/patents/US20050209248

(S)-N-[[3-fluoro-4-[N-1[4-{2-furyl-(5-nitro)methyl}]piperazinyl]-phenyl]-2-oxo-5-oxazolidinyl]-methyl]acetamidehydrochloride having the Formula I.

Figure US20050209248A1-20050922-C00001

 

The compound of Formula I, namely, (S)-N-[[3-fluoro-4-[N-1 [4-{2-furyl-(5-nitro)methyl}] piperazinyl]-phenyl]-2-oxo-5-oxazolidinyl]-methyl]acetamide hydrochloride is a phenyl oxazolidinone derivative, as disclosed in PCT application WO 02/06278. It is said to be useful as antimicrobial agent, effective against a number of human and veterinary pathogens, including gram-positive aerobic bacteria, such as multiply resistant staphylococci, streptococci and enterococci as well as anaerobic organisms such as Bacterioides spp. andClostridia spp. species, and acid fast organisms such as Mycobacterium tuberculosis, Mycobacterium avium and Mycobacterium spp.

The PCT application WO 02/06278 describes the preparation of compounds of Formula I. The products of Formula I obtained by following the cited methods tend to be hygroscopic and difficult to filter. These types of disadvantageous properties have proven to be serious obstacles to the large-scale manufacture of a compound. Further, handling problems are encountered during the preparation of pharmaceutical compositions comprising the hygroscopic compound of Formula I obtained by following the method disclosed in WO 02/06278.

EXAMPLE 1 Preparation of Polymorphic ‘Form A’ of the Compound of Formula I

50 gm of free base of Formula I was dissolved in ethanol (750 ml) by heating at about 60° C. and to this solution was added ethanolic HCl (13.36 ml, 8.9 N) at about 45-50° C. The reaction mixture was cooled to about 10° C., and stirred for about 4 hours. The separated solid was filtered off and dried under vacuum at 60° C. The solid was then digested in ethanol (150 ml) at 70-80° C. for about 4 hours. It was then cooled to about 10° C., the solid was filtered and dried under vacuum at 60-65° C. to give 30 gm of the pure polymorphic ‘Form A’ of compound of Formula I.

………………

 

Synthesis and SAR of novel oxazolidinones: Discovery of ranbezolid

Bioorg Med Chem Lett 2005, 15(19): 4261

http://www.sciencedirect.com/science/article/pii/S0960894X05008310

Synthesis and SAR of novel oxazolidinones: Discovery of ranbezolid

Pages 4261-4267
Biswajit Das, Sonali Rudra, Ajay Yadav, Abhijit Ray, A.V.S. Raja Rao, A.S.S.V. Srinivas, Ajay Soni, Suman Saini, Shalini Shukla, Manisha Pandya, Pragya Bhateja, Sunita Malhotra, Tarun Mathur, S.K. Arora, Ashok Rattan, Anita Mehta

 

Graphical abstract

Novel oxazolidinones were synthesized containing a number of substituted five-membered heterocycles attached to the ‘piperazinyl–phenyl–oxazolidinone’ core of eperezolid. Further, the piperazine ring of the core was replaced by other diamino-heterocycles. These modifications led to several compounds with potent activity against a spectrum of resistant and susceptible Gram-positive organisms, along with the identification of ranbezolid (RBx 7644) as a clinical candidate.

Substitution of five-membered heterocycles on to the ‘piperazinyl–phenyl–oxazolidinone’ core structure led to the identification of ranbezolid as a clinical candidate. Further replacement of piperazine ring with other diamino-heterocycles led to compounds with potent antibacterial activity.

image

Full-size image (8 K)

Scheme 5.

Reagents and conditions: (a) Method A: TFA, CH2Cl2, 0 °C → rt; 5-chloromethyl-2-furaldehyde, potassium carbonate, DMF, rt; or (b) Method B: TFA, CH2Cl2, 0 °C → rt; 5-nitrofuran-2-carboxaldehyde, sodiumtriacetoxyborohydride, THF, molecular sieves 3 Å, rt. 7 = ranbezolid

 

  • Synthesis of compound 7: (S)-N-[[3-[3-Fluoro-4-(N-4-tert-butoxycarbonyl-piperazin-1-yl)phenyl]-2-oxo-5-oxa-zolidinyl]-methyl]acetamide (28a, 3.65 kg, 8.37 mol) was dissolved in dichloromethane (30.86 L) and cooled to 5 °C. To it trifluoroacetic acid (6.17 L) added dropwise and stirred for 14 h allowing the reaction mixture to warm to rt. The reaction mixture was evaporated in vacuo and the residue dissolved in tetrahydrofuran (58 L) followed by addition of molecular sieves 4 Å (4.2 kg). To the resulting mixture 5-nitro-2-furaldehyde (1.5 kg, 10.77 mol) was added followed by sodium triacetoxyborohydride (5.32 kg, 25.1 mol) and stirred for 14 h. The reaction mixture was filtered over Celite and filtrate evaporated in vacuo. The residue was dissolved in ethylacetate (85.6 L) and washed with satd sodium bicarbonate solution (36 L) and water (36 L). The organic layer was dried over anhyd sodium sulfate (3 kg) and evaporated in vacuo. The crude residue was purified by column chromatography (1–3% methanol in ethylacetate) to obtain (S)-N-[[3-[3-fluoro-4-[N-4-(5-nitro-2-furylmethyl)-piperazin-1-yl]phenyl]-2-oxo-5-oxa-zolidinyl]methyl]acetamide (39, 2.6 kg, yield 67%). Mp: 136 °C. 1H NMR (CDCl3): δ 7.42 (dd, 1H, phenyl–H), 7.29 (m, 2H, furyl–H), 7.07 (d, 1H, phenyl–H), 6.92 (t, 1H, phenyl–H), 6.51 (d, 1H, furyl–H), 6.11 (t, 1H, –NHCO–), 4.77 (m, 1H, oxazolidinone ring C5–H), 4.01 (t, 1H), 3.85–3.45 (m, 5H), 3.09 (m, 4H, piperazine–H), 2.72 (m, 4H, piperazine–H), 2.02 (s, 3H, –COCH3). MS m/z (rel. int.): 462.1 [(M+H)+, 100%], 484 [(M+Na)+, 25%], 500.2 [(M+K)+, 20%]. HPLC purity: 98%.

  • Compound 39(3.6 kg, 7.81 mol) was dissolved in abs ethanol (53.8 L) by heating to 60 °C. The resulting solution was cooled to 45 °C and ethanolic hydrochloride (1.48 L, 7.9 N) was added dropwise in 10 min. The mixture was then cooled to 10 °C and stirred for 4 h and the precipitate formed was filtered and washed with ethanol and dried to obtain (S)-N-[[3-[3-fluoro-4-[N-4-(5-nitro-2-furylmethyl)-piperazin-1-yl]phenyl]-2-oxo-5-oxazolidinyl]-methyl]acetamide hydrochloride, ranbezolid (7, 3.2 kg, yield from 39: 82%, yield from 28a: 55%).

  • Ranbezolid
  • Mp: 207–209 °C.

  •  1H NMR (DMSO, 300 MHz): δ 8.30 (t, 1H, –NHCO–), 7.75 (d, J = 3.3 Hz, 1H, furyl–H), 7.52 (dd, 1H, phenyl–H), 7.3–7.0 (m, 3H, phenyl–H, furyl–H), 4.70 (m, 1H, oxazolidinone ring C5H), 4.63 (s, 2H), 4.08 (t, J = 8.8 Hz, 1H, –CH2–), 3.73 (t, J = 7.5 Hz, 1H), 3.43 (br m, piperazine–H merged with H2O in DMSO), 1.83 (s, 3H, –COCH3).

  • HPLC purity: 98%. Anal. Calcd for C21H25ClN5O6·0.5H2O: C, 50.76; H, 5.48; N, 14.09. Anal. Found: C, 50.83; H, 5.17; N, 13.83.

ADDED communication FROM/by DR VIJAY KAUL

vijay kaul

vijay kaul   EX RANBAXY SCIENTIST

General Manager, R&D at Calyx Chemicals & Pharmaceuticals Ltd.

  • in.linkedin.com/pub/vijay-kaul/b/aa9/962

DR VIJAY KAUL       QUOTE……………Kindly go through my patent describing a two step cost effective environmentally benign process for the key intermediate of Ranbezolid.
Process for the preparation of 4-(4-benzyloxy-carbonylamino-2-fluorophenyl)-piperazine-1-carboxylic acid tert-butyl ester W02005051933  ,……………….UNQUOTE

novel methods for the synthesis of the 4-(4- benzyloxy-carbonylamino-2-fluorophenyl)-piperazine-l-carboxylic acid tert-butyl ester of Formula I, which provides improvements over prior methods of synthesis. In one aspect, there is provided a process for the synthesis of highly pure 4-(4- benzyloxy-carbonylamino-2-fluorophenyl)-piperazine-l-carboxylic acid tert-butyl ester of Formula I,

 

Figure imgf000003_0001

Formula I comprising the steps of: condensing piperazine with l,2-difluoro-4-nitrobenzene to form l-(2-fluoro-4-nitro-phenyl)- piperazine of Formula II,

 

Figure imgf000004_0001

contacting the compound of Formula II with di-tert-butoxycarbonyl anhydride to form 4- (2- fluoro-4-nitrophenyl)-piperazine 1-carboxylic acid tert-butyl ester of Formula III,

 

Figure imgf000004_0002

reducing the compound of Formula III to form 4-(4-amino-2-fluorophenyl)-piperazin-l- carboxylic acid tert-butyl ester of Formula IV,

 

Figure imgf000004_0003

Formula IV and reacting the compound of Formula IN with benzylchloroformate to form 4-(4-benzyloxy- carbonylamino-2-fluorophenyl)-piperazine- 1-carboxylic acid tert-butyl ester of Formula I. In one aspect, the step of condensing piperazine with l,2-difluoro-4-nitrobenzene is carried out in an aromatic hydrocarbon, such as toluene, xylene and the like, or mixtures thereof, and at a temperature of, for example, about 40 °C to about 90 °C, or from about 80 °C to about 90 °C.

Oxazolidinone compounds can be prepared from compounds of Formula I using, for example, using methods disclosed in U.S. Patent No. 6,734,307 and PCT Publication Nos. WO 02/06278, WO 03/007870, WO 03/097059, WO04/089944 and WO04/14392, which are incorporated herein by reference. Scheme I below shows a synthetic route starting from a compound of Formula I to oxazolidinone compounds.

 

Figure imgf000006_0001

Formula lb

 

Figure imgf000006_0002

Formula lc

 

Figure imgf000006_0003

Formula Id Scheme I A compound of Formula I

 

Figure imgf000007_0001

Formula I can be reacted with a base, e.g., butyl lithium, and glycidyl butyrate to form a compound of

Formula la.

 

Figure imgf000007_0002

Formula la

The compound of Formula la can be reacted with methane sulphonyl chloride, followed by ammonium hydroxide, and finally acetyl halide of Formula CH3CO-hal (wherein hal is Br, CI or I) to form a compound of Formula lb.

 

Figure imgf000007_0003

Formula lb

The compound of Formula lb can be deprotected to form a compound of Formula Ic.

 

Figure imgf000007_0004

The compound of Formula Ic can be reacted with R-T-(W)0-ι-R12 to form a compound of Formula Id

Figure imgf000008_0001

EXAMPLE Preparation of 4-(4-benzyloxy-carbonylamino-2-fluorophenyl -piperazine- 1 – carboxylic acid tert-butyl ester of Formula I

Piperazine (0.77 mol, 66.2 g) was mixed with toluene (500 mL) and stirred at room temperature and subsequently stirred at 50 °C until a homogenous solution was obtained. 1,2- difluoro-4-nitrobenzene (0.314 mol, 50 g) was added to the piperazine/toluene solution and the reaction mixture was stirred at 80-90 °C for 3-6 hours.

The reaction mixture then was cooled to 40-45 °C and diluted with deionized water. The organic layer was separated and about 250-350 mL of toluene was evaporated off under reduced pressure at 40 °C. Di-tert- butoxycarbonyl anhydride (0.334mol, 75 g) was then added dropwise to the reaction mixture at room temperature. The resulting reaction mixture was stirred at room temperature for 1-2 hours and then further diluted with hexane (200 mL) and stirred for 15-20 minutes at room temperature.

The solid product formed in the reaction mixture was filtered, washed with hexane (150 mL), and dried under reduced pressure at 60-70°C to yield 4-(2-fluoro-4- nitrophenyl)-piperazine- 1-carboxylic acid tert butyl ester of Formula III. Yield = 1.8-1.9 (w\w); Purity = 96-98% by HPLC.

The compound of Formula III (0.246 mol, 80 g) was added to toluene (800 mL) followed by the addition of palladium on carbon (4 g) at room temperature with continuous stirring. Hydrogen gas was bubbled into the resulting reaction mixture at a pressure of 72 psi. The reaction mixture was stirred for 12-16 hours and then diluted with toluene (150 mL). The reaction mixture was filtered through a celite pad and washed with toluene (200 mL).

Sodium bicarbonate solution was added to the reaction mixture at room temperature with continuous stirring. Benzyl chloroformate (0.310 mol, 103 g) was added dropwise to the reaction mixture with continuous stirring for 2-3 hours. Ethyl acetate (1600 mL) was added to the reaction mixture and stirred for about 30 minutes followed by addition of deionized water (400 mL). The organic layer was separated and the solvent was removed under reduced pressure. The semi-solid product was washed with hexane (350 mL) to obtain 4-(4-benzyloxy- carbonylamino-2-fluorophenyl)-piperazine- 1-carboxylic acid tert-butyl ester of Formula I as a solid. Yield = 1.16-1.23 (w/w); Purity = 97-99% by HPLC.

References

  1. European Journal of Pharmacology. 2006. 545, 167–172
  2. US2005209248, 9-23-2005
    Plymorphic forms of phenyl oxazolidinone derivatives

  3. DU YU ET AL: “Synthesis and antibacterial activity of linezolid analogUES” BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, OXFORD, GB, vol. 12, 2002, pages 857-859, XP002245432 ISSN: 0960-894X
    2 * IN HWA CHUNG ET AL: “SYNTHESIS AND IN VITRO ANTIBACTERIAL ACTIVITY OF QUATERNARY AMMONIUM CEPHALOSPORIN DERIVATIVES BEARING OXAZOLIDINONE MOIETY” ARCHIVES OF PHARMACAL RESEARCH, NATL. FISHERIES UNIVERSITY, PUSAN, KR, vol. 22, no. 6, 1999, pages 579-584, XP001037701 ISSN: 0253-6269
    3 * PAE A N ET AL: “3D QSAR studies on new oxazolidinone antibacterial agents by comparative molecular field analysis” BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, OXFORD, GB, vol. 9, no. 18, 20 September 1999 (1999-09-20), pages 2685-2690, XP004179952 ISSN: 0960-894X
    4 * PAE A N ET AL: “Synthesis and In Vitro Activity of new Oxazolidinone Antibacterial Agents Having Substituted Isoxazoles” BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, OXFORD, GB, vol. 9, 1999, pages 2679-2684, XP002301080 ISSN: 0960-894X
    5 * TUCKER J A ET AL: “PIPERAZINYL OXAZOLIDINONE ANTIBACTERIAL AGENTS CONTAINING A PYRIDINE, DIAZENE, OR TRIAZENE HETEROAROMATIC RING” JOURNAL OF MEDICINAL CHEMISTRY, AMERICAN CHEMICAL SOCIETY. WASHINGTON, US, vol. 41, no. 19, 1998, pages 3727-3735, XP001203467 ISSN: 0022-2623
  4. 1-1-2013
    Anti-anaerobic potential of ranbezolid: insight into its mechanism of action against Bacteroides fragilis.
    International journal of antimicrobial agents
    11-15-2009
    Synthesis and biological activity of novel oxazolidinones.
    Bioorganic & medicinal chemistry letters
    4-1-2009
    Mode of action of Ranbezolid against staphylococci and structural modeling studies of its interaction with ribosomes.
    Antimicrobial agents and chemotherapy
    8-1-2008
    Effect of oxazolidinone, RBx 7644 (ranbezolid), on inhibition of staphylococcal adherence to plastic surfaces.
    Journal of chemotherapy (Florence, Italy)
    4-1-2008
    Utilization of Bombyx mori larvae as a surrogate animal model for evaluation of the anti-infective potential of oxazolidinones.
    Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy
    9-15-2007
    Synthesis and in vitro antibacterial activity of novel methylamino piperidinyl oxazolidinones.
    Bioorganic & medicinal chemistry letters
    9-18-2006
    Ranbezolid, a novel oxazolidinone antibacterial: in vivo characterisation of monoamine oxidase inhibitory potential in conscious rats.
    European journal of pharmacology
    10-1-2005
    Synthesis and SAR of novel oxazolidinones: discovery of ranbezolid.
    Bioorganic & medicinal chemistry letters
    6-1-2005
    Activity of RBx 7644 and RBx 8700, new investigational oxazolidinones, against Mycobacterium tuberculosis infected murine macrophages.
    International journal of antimicrobial agents
    10-1-2004
    In vitro activity of RBx 7644 (ranbezolid) on biofilm producing bacteria.
    International journal of antimicrobial agents
  5. 3-1-2003
    Antianaerobe activity of RBX 7644 (ranbezolid), a new oxazolidinone, compared with those of eight other agents.
    Antimicrobial agents and chemotherapy
    3-1-2003
    Antipneumococcal and antistaphylococcal activities of ranbezolid (RBX 7644), a new oxazolidinone, compared to those of other agents.
    Antimicrobial agents and chemotherapy
WO1993023384A1 * Apr 21, 1993 Nov 25, 1993 Michael Robert Barbachyn Oxazolidinones containing a substituted diazine moiety and their use as antimicrobials
WO1997030981A1 * Feb 18, 1997 Aug 28, 1997 Michael R Barbachyn Azolyl piperazinyl phenyl oxazolidinone antimicrobials
WO1998001447A1 * Jul 1, 1997 Jan 15, 1998 Michael John Betts Pyridyl-piperazinyl-phenyl-oxazolidinone derivatives and their use as antibacterials
WO2002006278A1 * Jul 16, 2001 Jan 24, 2002 Sudershan K Arora Oxazolidinone derivatives as antimicrobials
WO2002048139A2 * Dec 14, 2001 Jun 20, 2002 Robert C Gadwood Oxazolidinone photoaffinity probes
WO2003002560A1 * Jun 24, 2002 Jan 9, 2003 Castillo Juan Carlos Del New derivatives of oxazolidinones as antibacterial agents
WO2003007870A2 * May 10, 2002 Jan 30, 2003 Sudershan K Arora Oxazolidinone derivatives as antimicrobials
WO2004018439A1 * Aug 21, 2003 Mar 4, 2004 Shiv Kumar Agarwal Novel antibacterial agents

 

Gold Nanoparticles Made to Heat Up from Near-Infrared Light for Tumor Killing


Lyranara.me's avatarLyra Nara Blog

heat nanoparticles Gold Nanoparticles Made to Heat Up from Near Infrared Light for Tumor Killing

Gold has been a popular material to make nanoparticles because of its biocompatibility, but to get it to do some neat tricks isn’t enough to simply produce spherical gold nanoparticles. One limitation in using gold for killing tumors has been that cheap spherical gold nanoparticles are not plasmonic to near-infrared light, meaning they don’t heat up when such light illuminates them. Making gold nanoparticles plasmonic requires forming shapes out of the element that have been expensive to produce. Researchers at ETH Zurich (Eidgenössische Technische Hochschule Zürich) have developed a new technique for cheap manufacturing of different shapes of plasmonic gold-based nanoparticles that may open new possibilities for cancer treatment.

Instead of creating new shapes purely out of gold, a difficult process, the team instead arranged readily available spherical gold nanoparticles coated with silicon dioxide into plasmonic shapes. The silicon dioxide works like a spacer, keeping the gold spheres at predefined distances…

View original post 205 more words

SUTEZOLID for Treatment of tuberculosis


Sutezolid structure.svg

Sutezolid

168828-58-8

N-({(5S)-3-[3-fluoro-4-(thiomorpholin-4-yl)phenyl]-2-oxo-oxazolidin-5-yl}methyl) acetamide

(S)—N-[[3-[3-fluoro-4-(4-thiomorpholinyl)phenyl]-2-oxo-5-oxazolidinyl]methyl]acetamide

Sutezolid, PNU-100480, U-100480, NSC742407, PNU 100480, 168828-58-8, Sutezolid [INN]
Molecular Formula: C16H20FN3O3S   Molecular Weight: 353.41170

Sutezolid (PNU-100480, PF-02341272) is an oxazolidinone antibiotic currently in development as a treatment for extensively drug-resistant tuberculosis.

Rapid evaluation in whole blood culture of regimens for XDR-TB containing PNU-100480 (sutezolid), TMC207, PA-824, SQ109, and pyrazinamide

Sutezolid, an antimicrobial oxazolidinone and the thiomorpholine analogue of linezolid, had been in early clinical development for the treatment of tuberculosis. However, development was discontinued.

The compound had been found to be active against Gram-positive bacteria such as multiresistant staphylococci, streptococci and enterococci. It was being developed by Pfizer. In 2011, orphan drug designation was assigned in the U.S. and the E.U. for the treatment of tuberculosis.

In 2013, Sequella acquired an exclusive worldwide license for the development and commercialization of sustezolid.

8-5-2011
Combination Therapy for Tuberculosis

http://www.google.com/patents/US20110190199

Scheme 1 illustrates a general synthetic sequence for preparing compounds of the present invention.

 

Figure US20110190199A1-20110804-C00007

 

Example 3 Preparation of (5S)-5-{[(4-chlorobenzylidene)amino]methyl}-3-(3-fluoro-4-thiomorpholin-4-ylphenyl)-1,3-oxazolidin-2-one

The title compound in Example 2 (194 g, 0.56 mole), and the title compound of Example 1 (195 g, 0.84 mole), and lithium tert-butoxide (116 g, 1.4 mole) were charged into a 3000 mL three neck round bottom flask under nitrogen. The reactants were slurried with methyl tert-butyl ether (1200 mL) and the mixture was warmed to 56° C. and stirred for 2 h as a yellow solid gradually formed. The reaction was cooled to room temperature, and diluted with 1200 mL water. The mixture was then stirred vigorously over 60 min as the solid changed from dark yellow to a more pale yellow solid. The mixture was cooled to 10° C., filtered, and the filter cake was washed with ice cold methyl tert-butyl ether (450 mL). The resulting light yellow solid was dried in air for 30 min, then placed in a vacuum oven and dried at 40° C. overnight to afford the title compound (243 g, 99% yield). 1H NMR (400 MHz, CDCl3): δ 2.8 (m, 4H), 3.2 (m, 4H), 3.9 (m, 2H), 4.1 (m, 2H), 5.0 (m, 1H), 6.9 (m, 1H), 7.2 (m, 1H), 7.4 (m, 3H), 7.6 (m, 2H), 8.4 (s, 1H).

Example 4 Preparation of N-{[(5S)-3-(3-fluoro-4-thiomorpholin-4-ylphenyl)-2-oxo-1,3-oxazolidin-5-yl]methyl}acetamide

The title compound in Example 3 (243 g, 0.56 mole) was combined with EtOAc (1300 mL) and water (1300 mL) in a 5000 mL three neck round bottom flask equipped with a mechanical stirrer. The mixture was treated drop-wise with 12N HCl (140 mL, 1.68 moles) and the mixture was stirred vigorously for 1 hour at room temperature. The layers were separated and the aqueous layer was washed with EtOAc (1×500 mL). The resulting aqueous solution containing (S)-5-(aminomethyl)-3-(3-fluoro-4-thiomorpholinophenyl)oxazolidin-2-one hydrochloride was combined with a mixture of dichloromethane (1800 mL) and MeOH (120 mL), and the vigorously stirred mixture was charged with acetic anhydride (132 mL, 1.4 mole) in one portion and subsequently treated drop-wise with 10 N NaOH (200 mL, 2.0 mole) over 15 min. An extremely thick reaction mixture resulted from addition of the base, which gradually thinned as the pH rose and the acylation rapidly progressed. The reaction was stirred vigorously for 1 hour after the mixture resolved to two phases. At that time, 10 M NaOH (160 mL, 1.6 mole) was added drop-wise to the mixture until the pH was stable at 7. The layers were separated, the aqueous layer was extracted with dichloromethane (250 mL), and the combined organic layers were dried over anhydrous potassium carbonate. The volatiles were removed in vacuo to give an off-white solid which was titrated with methyl tert-butyl ether (250 mL), collected, and dried in vacuo to give title compound (5) (186.1 g, 94% yield) as a fine white solid with greater than 98% HPLC purity (retention time=3.93 minutes, HPLC conditions reported below).

The crude solid was dissolved in warm 6% methanol in dichloromethane (1250 mL) in a 5000 mL three neck round bottom flask equipped with a mechanical stirrer. The solution was warmed to reflux, diluted by the portion-wise (500 mL) addition of 2500 mL isopropanol (IPA), and, in order to maintain reflux, the temperature was ramped to 50-70° C. On completion of this addition of IPA, the reflux condenser was replaced with a short-path distillation head and distillation was continued into a cooled flask. During distillation, a 500 mL portion of fresh IPA was added after 500 mL of distillate was collected to maintain between 2000 and 2500 mL IPA present at all times. After this addition (internal flask temperature dropped to 60° C.) the mixture became slightly cloudy and remained so for the balance of the distillation, becoming increasingly cloudy as the distillate temperature exceeded 70° C.; particulate matter appeared as the distillate temperature exceeded 75° C. The temperature controller was ramped to 85° C. and held there until the conclusion of the distillation. When the distillate was clearly isopropanol alone (82-83° C.) the volume was reduced to 2500 mL hot IPA, the heating mantle was removed, stirring was discontinued, and the paddle was removed from the flask. The mixture was allowed to continue to crystallize as the flask cooled. The white crystalline solid was then collected by filtration, washed with methyl tert-butyl ether (250 mL), and dried in vacuo at 40° C. to afford 180 g (91% yield) of the title compound in greater than 99% HPLC purity (retention time=3.93 minutes, HPLC conditions reported below). 1H NMR (400 MHz, DMSO-d6): δ 1.8 (s, 3H), 2.7 (m, 4H), 3.2 (m, 4H), 3.4 (m, 2H), 3.7 (m, 1H), 4.7 (m, 1H), 7.1 (m, 1H), 7.15 (m, 1H), 7.2 (m, 1H), 8.2 (m, 1H). Mass Spec. C16H20FN3O3S: m/z 354.1 (M+1).

HPLC conditions for analyses mentioned in the text: HP Series 1100; Column: Symmetry C8 5 uM 4.6×50 mm; Flow rate 1.2 mL/min; Solvent A: water with 0.1% formic acid, Solvent B: acetonitrile with 0.1% formic acid; Injection volume=10 uL of 1 mg/mL (acetonitrile); Gradient: Solvent B 0-100% over 7 minutes then 100% B for 1 minute; wavelength=254 nm.

 

Identification of a novel oxazolidinone (U-100480) with potent antimycobacterial activity
J Med Chem 1996, 39(3): 680

http://pubs.acs.org/doi/full/10.1021/jm950956y

Figure

(S)-N-[[3-[3-Fluoro-4-(4-thiomorpholinyl)phenyl]-2-oxo-5oxazolidinyl]methyl]acetamide (6, U-100480). A solution of (R)-[3-[3-fluoro-4-(4-thiomorpholinyl)phenyl]-2-oxo-5-oxazolidinyl]methyl azide (19.662 g, 58.28 mmol) in dry THF (290 mL) was treated with triphenylphosphine (16.815 g, 64.11 mmol) over 10 min. After 2.0 h, TLC analysis (10% MeOH/CHCl3) revealed the conversion to iminophosphorane was complete. H2O (2.10 mL, 116.56 mmol) was added and the reaction mixture heated to 40 °C (internal temperature) for 5 h and then allowed to cool to ambient temperature overnight. At this point, TLC analysis (10% MeOH/CHCl3) indicated incomplete hydrolysis of the iminophosphorane intermediate. More H2O (8.40 mL) was added, and the reaction was heated to 40 °C for 5 h. At this time, TLC indicated complete conversion to the 5-(aminomethyl)oxazolidinone intermediate. The reaction mixture was first concentrated by rotary evaporation (benzene was added several times to azeotrope off the H2O) and then under high vacuum to give the crude amine as an off-white solid. This material was dissolved in CH2Cl2 (250 mL), treated with pyridine (46.099 g, 47.10 mL, 582.79 mmol) and acetic anhydride (29.749 g, 27.49 mL, 291.40 mmol), and then stirred overnight at ambient temperature. TLC analysis (10% MeOH/CHCl3) showed complete conversion to 6. The reaction mixture was diluted with CH2Cl2, transferred to a separatory funnel, and then washed with 1 N HCl until the washings were acidic. The organic layer was then washed with saturated aqueous NaHCO3 and brine, dried over Na2SO4, filtered, and concentrated in vacuo to give crude 6 (U-100480) as a cream-colored solid. The crude product was triturated with hot CHCl3; most but not all of the solids dissolved. After cooling to ambient temperature, the solids were filtered off (cold CHCl3 wash) and dried in vacuo to furnish 13.174 g of analytically pure title compound as a white solid. A second crop of 3.478 g, also analytically pure, afforded a combined yield of 81%:

mp 186.5−187.0 oC; [α]D −8° (c 1.00, CHCl3);

IR (mull) 1749, 1746, 1641, 1656, 1518, 1448, 1419, 1225, 1215, 1158, 1106, 1083, 867 cm-1;

 1H NMR (300 MHz, CDCl3) δ 7.42 (dd, 1H, J = 2.6, 14.0 Hz), 7.06 (ddd, 1H, J = 1.0, 2.6, 8.8 Hz), 6.95 (dd, 1H, J = 9.0, 9.0 Hz), 6.61 (br t, 1H, J = 6.0 Hz), 4.81−4.72 (m, 1H), 4.02 (dd, 1H, J = 9.0, 9.0 Hz), 3.75 (dd, 1H, J = 6.7, 9.1 Hz), 3.71−3.55 (m, 2H), 3.32−3.27 (m, 4H), 2.84−2.79 (m, 4H), 2.02 (s, 3H);

MS m/z (rel intensity) 353 (M+, 100), 309 (31), 279 (5), 250 (17), 235 (14), 225 (20), 212 (7), 176 (19), 138 (18), 42 (28);

HRMS calcd for C16H20N3O3FS 353.1209, found 353.1200. Anal. (C16H20N3O3FS) C, H, N.

see aLSO

WO 1995007271

WO 2010026526

Repurposed drugs for tuberculosis treatment.

http://www.nature.com/nrd/journal/v12/n5/fig_tab/nrd4001_F1.html

Repurposed drugs for tuberculosis treatment.

EPEREZOLID


Eperezolid.png

EPEREZOLID

pfizer.originator

 CAS NO  165800-04-4 

Eperezolid [USAN], PNU 100592, U-100592,
Molecular Formula: C18H23FN4O5
Molecular Weight: 394.397423

(S)-N-[[3-[3-Fluoro-4-[4-(2-hydroxyacetyl)piperazin-1-yl]phenyl]-2-oxo-1,3-oxazolidin-5-yl]methyl]acetamide

(S)-N-[[3-[3-fluoro-4-[4-(hydroxyacetyl)-l-piperazinyl]- phenyl]-2-oxo-5-oxazolidinyl]methyl]acetamide

Oxazolidinones are a new class of Gram-positive antibacterial agents which are known to those skilled in the art, see for example US 5,688,792. (S)-N-[[3-[3- fluoro-4-(4-morpholinyl)phenyl]-2-oxo-5-oxazolidinyl]methyl]acetamide, known as linezolid, the compound of Example 5 of US Patent 5,688,792 is known and has the following chemical formula:

 

(S)-N-[[3-[3-fluoro-4-[4-(hydroxyacetyl)-l-piperazinyl]-phenyl]-2-oxo-5- oxazolidinyl]methyl]acetamide, known as eperezolid, the compound of

Example 8 of US Patent 5,837,870 is known and has the following chemical formula:

 

Linezolid and eperezolid can be produced by the processes set forth in US Patents 5,688,791 and 5,837,870 as well as that of International Publication WO99/24393. It is preferably produced by the process of US Patent 5,837,870.

It is preferred that the linezolid produced be used in crystal form π, which has the characteristics set forth in CHART A. Once linezolid is synthesized, crystal Form π is prepared by starting with linezolid of high enantiomeric purity. It is preferred that the linezolid be more than 98% enantiomerically pure, it is more preferred that the linezolid be more than 99% pure and it is even more preferred that the linezolid be 99.5% pure. The linezolid of greater than 98% enantiomeric purity to be used to form crystal form II can either be in solution or be a solid. The linezolid starting material, solid or solution, is mixed with a solvent selected from the group consisting of compounds of the formula: water, acetonitrile, chloroform, methylene chloride, R OH where R\ is Cι-C6 alkyl; Rι-CO-R2 where R2 is Cι-C alkyl and Ri is as defined above; phenyl substituted with 1 thru 3 Ri where Ri is as defined above; Rι-CO-O-R2 where Ri is -C alkyl and Ri is as defined above; Rι-O-R2 where

is Cι-C6 alkyl and Ri is as defined above. It is preferred that the solvent be selected from the group consisting of water, ethyl acetate, methanol, ethanol, propanol, isopropanol, butanol, acetonitrile, acetone, methyl ethyl ketone, chloroform, methylene chloride, toluene, xylene, diethyl ether, or methyl-t-butyl ether. It is more preferred that the solvent be ethyl acetate, acetone, acetonitrile, propanol, or isopropanol. It is most preferred that the solvent be ethyl acetate. The mixture of linezolid in the solvent is agitated at a temperature below 80° until crystals of Form II are formed and crystals of other solid forms, such as Form I, disappear. It is preferred to dissolve the linezolid in ethyl acetate at a temperature near the boiling point of the solvent. This mixture is cooled to a temperature of about 70°. The mixture may be seeded with crystals of Form II to facilitate crystallization. It is preferred that the solid product is cooled and agitated at a temperature between about 45° and about 60° until the solids consist only of Form II crystals. It is most preferred to maintain the slurry at a temperature of about 55°. It is preferred to mix the linezolid and solvent for at least 10 min, it is even more preferred to mix the linezolid and solvent for at least 20 min and it is most preferred to mix the linezolid and solvent for at least 30 min. The time and temperature will vary depending on the solvent selected. With ethyl acetate it is preferred to mix for not less that 60 minutes. The crystalline slurry may be further cooled to improve yield, and the solid Form II product may be isolated. The mixture may be further cooled and agitated. Other measures which can be used to facilitate crystallization include, but are not limited to, cooling, concentration of the solution by evaporation or distillation, or through addition of other solvents. The crystals are isolated by procedures known to those skilled in the art.

It is well known to those skilled in the art that the oxazolidinones are useful as anti-bacterial agents especially against Gram-positive organisms. US Patent 5,688,792 discloses that oxazolidinones can be administered IV. The preferred formulation for linezolid IV solution is: Linezolid 2.0 mg mL

Sodium Citrate Dihydrate (USP) 1.64 mg/mL

Citric Acid Anhydrous (USP) 0.85 mg/mL

Dextrose Monohydrate (USP) 50.24 mg/mL

Hydrochloric Acid ( 10%) q.s. to pH 4.8 (pH 4.6 to 5.0) Sodium hydroxide (10%) q.s. to pH 4.8 (pH 4.6 to 5.0)

Water for Injection (USP) q.s. ad 1.0 mL

The linezolid IV solution is formulated by heating water for injection from about 50 to about 65°. Next the sodium citrate, citric acid and dextrose are added and stirred until dissolved. An aqueous slurry of linezolid is added to the previous mixture and stirred until dissolved. The mixture is cooled to 25° with stirring. The pH is measured and adjusted if necessary. Last the mixture is brought to volume, if necessary, with water for injection. The mixture is filtered, filled into infusion containers, over wrapped and terminally moist heat sterilized.

The aqueous solution for IV administration can be placed in the container which is selected from the group consisting of a bag, a bottle, a vial, a large volume parenteral, a small volume parenteral, a prefilled syringe and a cassette. It is realized that a vial is a bottle. However, those skilled in the art use the term “bottle” to refers to larger bottles and “vials” to refer to smaller bottles. It is preferred that the container be a bag, a bottle, a vial or a prefilled syringe. It is more preferred that the container be a bag or bottle. It is most preferred that the container be a bag. The shape and/or size of the container is unimportant. It is preferred that the container be a bag sufficient to hold 25 to 2,000 mL of IV solution. It is preferred that the linezolid mixture be put in bags in amounts of 100, 200 or 300 mL of solution however smaller or larger volumes are acceptable.

……………..

http://www.google.com/patents/WO2007138381A2?cl=en

. Scheme 2. Synthesis of eperezolid

 

RR==IH-

s

 

Et3N,

 

 

17 (eperezolid)

1-(2-Fluoro-4-nitrophenyl)piperazine (8). To 3,4-difluoronitrobenzene (20.5 g, 129 mmol) in acetonitrile (290 mL) was added triethylamine (36 mL) and piperazine (32 g, 387 mmol). The mixture was stirred at reflux for 18 h, after which it was cooled to room temperature and partitioned between H2O (500 mL) and EtOAc (400 mL). The layers were separated and the aqueous layer was extracted with EtOAc (2 x 300 mL). The organic layers were combined and washed with saturated NaCI solution (400 mL). The saturated NaCI layer was extracted again with EtOAc (2 x 200 mL). The organic layers were combined, dried over Na2SO4, filtered and concentrated to yield 8 as a yellow solid (29 g, quant.). 1H NMR (400 MHz, CDCI3) δ 1.63 (s, 1 H), 3.04-3.06 (m, 4H), 3.25-3.28 (m, 4H), 6.91 (t, J=8.7, 1 H), 7.90 (dd, J=13.2, 2.5, 1 H), 7.97- 8.00 (m, 1H).

3-Fluoro-4-(piperazin-1-yl)benzenamine (9). Compound 8 (10.0 g, 44.4 mmol) was dissolved in anhydrous EtOH (222 mL) and placed in a Parr pressure flask. PtO2 catalyst (31 mg) was added and the mixture was agitated under 50-60 psi of H2 on a Parr apparatus for 30 min, after which the reaction mixture was vented, more catalyst was added (78 mg) and the reaction mixture was submitted to 50-60 psi of H2 for another 30 min. The reaction mixture was filtered on Celite, the solid was washed with MeOH1 and the combined filtrates were concentrated to give 9 as a yellow solid (8.7 g, quant.). 1H NMR (400 MHz, CDCI3) δ 1.64 (bs,

1 H), 2.92-2.94 (m, 4H), 3.02-3.04 (m, 4H), 5.53 (bs, 2H)1 6.38-6.45 (m, 2H), 6.80 (t, J=8.5, 1 H).

Benzyl 4-(4-((benzyloxy)carbonyl)piperazin-1 -yl)-3-fluorophenylcarbamate (10).

Compound 10 was obtained in 78% yield (light yellow solid) using the protocol described in J. Med. Chem. 1996, 39, 673-679. 1H NMR (400 MHz, CDCI3) δ 2.98 (bs, 4H), 3.65-3.68 (m, 4H),

5.16 (s, 2H), 5.19 (s, 2H), 6.59 (bs, 1H), 6.85 (t, J=9.1 , 1 H), 6.94-6.97 (m, 1 H), 7.27-7.41 (m,

11H).

Benzyl 4-(2-fluoro-4-((R)-5-(hydroxymethyl)-2-oxo-oxazolidin-3-yl)phenyl) piperazine-1-carboxylate (11). Compound 11 was obtained in 66% yield (off-white solid) using the protocol described in J. Med. Chem. 1996, 39, 673-679. 1H NMR (400 MHz, CDCI3) δ 3.01

(bs, 4H), 3.66-3.69 (m, 4H), 3.74-3.79 (m, 1H)1 3.92-4.03 (m, 3H), 4.71-4.77 (m, 1H), 5.16 (s,

2H), 6.91 (t, J=9.1 , 1 H), 7.11-7.14 (m, 1H), 7.91-7.38 (m, 5H), 7.46 (dd, J=14.2, 2.5, 1 H).

Benzyl 4-(2-fluoro-4-((/?)-5-(methanesulfonyloxymethyl)-2-oxo-oxazolidin-3- yl)phenyl) piperazine-1-carboxylate (12). Compound 12 was obtained in quantitative yield (off- white foam) using the protocol described in J. Med. Chem. 1996, 39, 673-679. 1H NMR (400 MHz, CDCI3) δ 3.02 (bs, 4H), 3.10 (s, 3H), 3.67-3.69 (m, 4H), 3.92 (dd, J=9.1 , 6.1 , 1 H), 4.12 (t, J=QA, 1H), 4.44 (dd, J=11.7, 3.8, 1H), 4.49 (dd, J=11.7, 3.8, 1H), 4.88-4.94 (m, 1H), 5.16 (s, 2H), 6.93 (t, J=9.1 , 1 H), 7.08-7.12 (m, 1 H), 7.30-7.38 (m, 5H), 7.44 (dd, J=14.0, 2.6, 1 H).

Benzyl 4-(4-((S)-5-(aminomethyl)-2-oxo-oxazolidin-3-y!)-2-fluorophenyl) piperazine- 1-carboxylate (13). Compound 13 was obtained in 70% yield from 12 (4.4 g, 8:67 mmol), following the same procedure as for compound 6. After work-up, crude 13 was purified by flash chromatography using a gradient of 0-2-5-10% MeOH / CHCI3 as eluent. 1H NMR (400 MHz,

CDCI3) δ 1.33 (bs, 2H), 2.94-3.03 (m, 5H), 3.11 (dd, J=13.7, 4.1 , 1 H), 3.66-3.69 (m, 4H)1 3.82

(dd, J=8.6, 6.7, 1 H), 4.00 (t, J=8.7, 1 H)14.63-4.69 (m, 1 H), 5.16 (s, 2H), 6.91 (t, J=9.1 , 1 H)17.12- 7.15 (m, 1 H)1 7.30-7.38 (m, 5H)1 7.47 (dd, J=14.3, 2.6, 1 H).

Benzyl 4-(4-((S)-5-(acetylaminomethyl)-2-oxo-oxazolidin-3-yl)-2-fluorophenyl) piperazine-1-carboxylate (14). Compound 14 was obtained in 90% yield from 13 (5.3 g, 12.4 mmol), following the same procedure as for compound 7. After work-up, the compound was used without any further purification. 1H NMR (400 MHz, CDCI3) δ 2.02 (s, 3H), 3.01 (bs, 4H), 3.57-3.77 (m, 7H)14.01 (t, J=9.0, 1 H)14.73-4.79 (m, 1 H)1 5.16 (s, 2H)16.05 (t, J=6.2, 1H)16.91 (t, J=9.2, 1H), 7.05-7.08(m, 1 H)1 7.32-7.38 (m, 5H)1 7.44 (dd, J=14.2, 2.62, 1 H).

Λ/-[((S)-3-(3-fluoro-4-(piperazin-1-yl)phenyl]-2-oxo-oxazolidin-5-yl)methyl)acetamide (15). To a solution of 14 (748 mg, 1.59 mmol) in abs. ethanol (40 ml.) was added cyclohexene (1 ml.) and 10% Pd / C (400 mg). The mixture was refluxed for 2 h, when TLC indicated complete reaction. The reaction mixture was filtered through celite and concentrated to give 15 as an off-white solid (520 mg, 97%). The product was essentially pure, but could be purified by chromatography (90:10:1.5 CH2CI2:MeOH:conc. NH4OH). 1H NMR (400 MHz, CDCI3) 52.01 (s, 3H), 3.02 (d, J=Al, 8H), 3.57-3.76 (m, 3H), 4.01 (t, J=9.0, 1H), 4.73-4.79 (m, 1H), 6.29 (m, 1H)1 6.92 (t, J=9.1 , 1 H), 7.04-7.07(m, 1 H), 7.39-7.43 (m, 1 H).

Λ/-(((S)-3-(4-(4-(2-(benzyloxy)acetyl)piperazin-1-yl)-3-fluorophenyl)-2-oxooxazolidin- 5-yl)methyl)acetamide (16). To a solution of 15 (537 mg, 1.60 mmol) and triethylamine (0.22 mL, 3.53 mmol) in CH2CI2 (35 mL) at 0 0C was added benzyloxyacetyl chloride (0.30 ml_, 1.92 mmol). The mixture was stirred at 0 0C for 1 h, then 15 min at room temperature when TLC indicated complete reaction. The reaction mixture was washed with water (2 x 30 mL), and saturated sodium bicarbonate (2 x 30 mL), and dried over MgSO4. After chromatography (gradient elution 5-10% MeOH / CH2CI2) the product was obtained as a white foam (709 mg, 91%). 1H NMR (400 MHz, CDCI3) δ 2.02 (s, 3H), 2.98-3.14 (m, 4H), 3.56-3.86 (m, 7H), 4.02 (t, J=9.0, 1 H), 4.22 (S, 2H), 4.62 (s, 2H), 4.73-4.80 (m, 1H)1 6.02 (t, J=5.9,1 H), 6.96-7.10 (m, 2H), 7.28-7.40 (m, 5H), 7.45-7.53 (m, 1 H).

Λ/-(((S)-3-(3-fluoro-4-(4-(2-hydroxyacetyl)piperazin-1-yl)phenyl)-2-oxooxazoiidin-5- yl)methyl)acetamide (17, eperezolid). To a solution of 16 (709 mg, 1.46 mmol) in abs. ethanol (40 mL) was added cyclohexene (1 mL) and 10% Pd / C (250 mg). The mixture was refluxed for 15 h, when TLC indicated complete reaction. The reaction mixture was filtered through Celite™ and concentrated to give 17 (470 mg, 82% yield). The product was essentially pure, but could be purified by chromatography. 1H NMR (400 MHz, CDCI3) δ 2.02 (s, 3H), 3.06-3.10 (m, 4H), 3.45-3.50 (m, 2H), 3.58-3.77 (m, 3H), 3.85-3.87 (m, 2H), 4.02 (t, J=9.0, 1 H), 4.21 (s, 2H), 4.74- 4.80 (m, 1H), 6.09 (t, J=6.0, 1 H), 6.97 (t, J=QA , 1 H), 7.07-7.10 (m, 1 H), 7.46-7.50 (m, 1 H). LCMS : 96.1% (254 nm), 95.1% (220 nm), 94.5% (320 nm). MS : 395 (MH)+.

……………….

http://www.google.com/patents/WO1997037980A1

EXAMPLE 8 (S)-N-[[3-[3-fluoro-4- 4-(hydro3ζyacetyl)-l-piperazinyl]-phenyl]-2- oxo-5-oxazoHdinyl]methylJ-acetamide sesquihydrate (VIII) To a stirred mixture of (S)-N-[[3-[3-fluoro-4-(l-piperazinyl)phenyl]-2-oxo-5- oxazoHdinyl]methyl]acetamide hydrochloride (EXAMPLE 7, 16.2 kg, 43.5 moles), tetrahydrofuran (205 kg) and triethylamine (10.1 kg, 100 moles) is added acetoxyacetyl chloride (6.5 kg, 47.8 moles) in tetrahydrofuran (11.1 kg) over 35 minutes keeping the temperature at 22-23°. After 40 minutes, at which time TLC and HPLC analysis indicated complete formation of the acetoxyacetamide intermediate, the mixture is concentrated under reduced pressure to 30 1, diluted with methanol (100 1) and concentrated to 30 1. To the residue is added methanol (25 1) and an aqueous solution of potassium carbonate (5.6 kg in 56 1). The resulting mixture is stirred 20 hr at 22-25° at which time TLC and HPLC analysis indicates the reaction is complete. The pH is adjusted to 7-7.5 with hydrochloric acid (4 N, 14.3 1). The mixture is stirred 18 hr at 15-22° then 3 hrs at 2-5°. The soHds are collected on a filter, washed with water (68 1) and dried at 20-25° with recycled nitrogen to give the desired product. The crude product is dissolved in water (225 1) at 60-70°, clarified through a 0.6 micron filter, diluted with water rinse (55 1) and stirred 17 hrs. at 15°. The solids are collected on a filter, washed with water at 15° and dried at 45° with recycled nitrogen to a water content of 0.33%. These soHds are dissolved in a solution of ethyl acetate (143 1), methanol (65 1) and water (1.95 1) at 60-65°. The solution is cooled to 15-25° and stirred 16 hrs for crystallization. The soHds are coUected on a filter, washed with ethyl acetate (75 1) and dried with 45° nitrogen to give the desired product. The product is recrystallized two more times from water (147 1 then 133 1) at 60-70°, clarified each time through a 0.6 micron filter and rinsed with water (40 1 and 30 1). The soHds are dried on the filter at 30° with recycled nitrogen to give, after deagglomeration through a mill, the title compound as the sesquihydrate (6.45% water), TLC (siHca gel; methanol/methylene chloride, 5/95) Rf = 0.45; [α]D = -20° (c = 1.0, ethanol).

 

 

pamidronate eperezolid

12-8-2000
BICYCLIC OXAZOLIDINONES AS ANTIBACTERIAL AGENT
8-4-2000
ASSAYS FOR MODULATORS OF ELONGATION FACTOR P ACTIVITY
3-22-2000
Method of treating psoriasis, arthritis and reducing the toxicity of cancer chemotherapy
12-17-1999
MULTIVALENT MACROLIDE ANTIBIOTICS MULTIVALENT MACROLIDE ANTIBIOTICS MULTIVALENT MACROLIDE ANTIBIOTICS
8-4-2004
BICYCLIC HETEROCYCLIC SUBSTITUTED PHENYL OXAZOLIDINONE ANTIBACTERIALS, AND RELATED COMPOSITIONS AND METHODS
9-12-2003
Bicyclic heterocyclic substituted phenyl oxazolidinone antibacterials, and related compositions and methods
8-20-2003
Bicyclic heterocyclic substituted phenyl oxazolidinone antibacterials, and related compositions and methods
4-9-2003
Compositions and methods for treating bacterial infections
2-12-2003
Piperidinyloxy and pyrrolidinyloxy oxazolidinone antibacterials
2-5-2003
Oxazolidinone tablet formulation
7-3-2002
Bicyclic heterocyclic substituted phenyl oxazolidinone antibacterials, and related compositions and methods
11-30-2001
Treatment of urinary tract infections with antibacterial oxazolidinones
10-3-2001
N-substituted amidine and guanidine oxazolidinone antibacterials and methods of use thereof
6-27-2001
Enhancement of oxazolidinone antibacterial agents activity by using arginine derivatives
8-15-2012
Oxazolidinone derivatives with cyclic amidoxime or cyclic amidrazone pharmaceutical compositions thereof
10-20-2010
Oxazolidinone derivatives
7-31-2009
NOVEL OXAZOLIDINONE DERIVATIVES
6-20-2008
PREPARATION AND UTILITY OF SUBSTITUTED OXZOLIDINONES
9-19-2007
Antibiotic conjugates
3-31-2006
Antibiotic conjugates
10-5-2005
Pyridoarylphenly oxazolidinone antibacterials, and related compositions and methods
4-8-2005
Container for linezolid intravenous solution
1-21-2005
Substituted isoxazoles and their use as antibiotics
9-29-2004
Container for linezolid intravenous solution

Tuberculosis: the drug development pipeline at a glance.


Tuberculosis: The drug development pipeline at a glance

Review Article
Pages 1-16
Baptiste Villemagne, Céline Crauste, Marion Flipo, Alain R. Baulard, Benoit Déprez, Nicolas Willand

 

Graphical Abstract

image

Highlights

► This review presents anti-tuberculosis compounds currently in clinical trials. ► Promising strategies in preclinical development are described. ► The chemical synthesis, target and mechanism of action are highlighted. ► Activities observed in preclinical and clinical studies are reported.

 

Tuberculosis is a major disease causing every year 1.8 million deaths worldwide and represents the leading cause of mortality resulting from a bacterial infection. Introduction in the 60’s of first-line drug regimen resulted in the control of the disease and TB was perceived as defeating. However, since the progression of HIV leading to co-infection with AIDS and the emergence of drug resistant strains, the need of new anti-tuberculosis drugs was not overstated. However in the past 40 years any new molecule did succeed in reaching the market. Today, the pipeline of potential new treatments has been fulfilled with several compounds in clinical trials or preclinical development with promising activities against sensitive and resistant Mycobacterium tuberculosis strains. Compounds as gatifloxacin, moxifloxacin, metronidazole or linezolid already used against other bacterial infections are currently evaluated in clinical phases 2 or 3 for treating tuberculosis. In addition, analogues of known TB drugs (PA-824, OPC-67683, PNU-100480, AZD5847, SQ609, SQ109, DC-159a) and new chemical entities (TMC207, BTZ043, DNB1, BDM31343) are under development. In this review, we report the chemical synthesis, mode of action when known, in vitro and in vivo activities and clinical data of all current small molecules targeting tuberculosis.

Eur J Med Chem. 2012 May;51:1-16. doi: 10.1016/j.ejmech.2012.02.033. Epub 2012 Feb 25.

Villemagne, B.; Crauste, C.; Flipo, M.; Baulard, A.R.; Déprez, B.; Willand, N. Tuberculosis: Villemagne, B.; Crauste, C.; Flipo, M.; Baulard, A.R.; Déprez, B.; Willand, N. Tuberculosis: The drug development pipeline at a glance. . Eur. J. Med. Chem. 201251, 1–16, doi:10.1016/j.ejmech.2012.02.033.