New Drug Approvals

Home » Uncategorized (Page 104)

Category Archives: Uncategorized

DRUG APPROVALS BY DR ANTHONY MELVIN CRASTO .....FOR BLOG HOME CLICK HERE

Blog Stats

  • 4,932,519 hits

Flag and hits

Flag Counter

Enter your email address to follow this blog and receive notifications of new posts by email.

Join 37.8K other subscribers
Follow New Drug Approvals on WordPress.com

Archives

Categories

Recent Posts

Flag Counter

ORGANIC SPECTROSCOPY

Read all about Organic Spectroscopy on ORGANIC SPECTROSCOPY INTERNATIONAL 

Enter your email address to follow this blog and receive notifications of new posts by email.

Join 37.8K other subscribers
DR ANTHONY MELVIN CRASTO Ph.D

DR ANTHONY MELVIN CRASTO Ph.D

DR ANTHONY MELVIN CRASTO, Born in Mumbai in 1964 and graduated from Mumbai University, Completed his Ph.D from ICT, 1991,Matunga, Mumbai, India, in Organic Chemistry, The thesis topic was Synthesis of Novel Pyrethroid Analogues, Currently he is working with AFRICURE PHARMA, ROW2TECH, NIPER-G, Department of Pharmaceuticals, Ministry of Chemicals and Fertilizers, Govt. of India as ADVISOR, earlier assignment was with GLENMARK LIFE SCIENCES LTD, as CONSUlTANT, Retired from GLENMARK in Jan2022 Research Centre as Principal Scientist, Process Research (bulk actives) at Mahape, Navi Mumbai, India. Total Industry exp 32 plus yrs, Prior to joining Glenmark, he has worked with major multinationals like Hoechst Marion Roussel, now Sanofi, Searle India Ltd, now RPG lifesciences, etc. He has worked with notable scientists like Dr K Nagarajan, Dr Ralph Stapel, Prof S Seshadri, etc, He did custom synthesis for major multinationals in his career like BASF, Novartis, Sanofi, etc., He has worked in Discovery, Natural products, Bulk drugs, Generics, Intermediates, Fine chemicals, Neutraceuticals, GMP, Scaleups, etc, he is now helping millions, has 9 million plus hits on Google on all Organic chemistry websites. His friends call him Open superstar worlddrugtracker. His New Drug Approvals, Green Chemistry International, All about drugs, Eurekamoments, Organic spectroscopy international, etc in organic chemistry are some most read blogs He has hands on experience in initiation and developing novel routes for drug molecules and implementation them on commercial scale over a 32 PLUS year tenure till date Feb 2023, Around 35 plus products in his career. He has good knowledge of IPM, GMP, Regulatory aspects, he has several International patents published worldwide . He has good proficiency in Technology transfer, Spectroscopy, Stereochemistry, Synthesis, Polymorphism etc., He suffered a paralytic stroke/ Acute Transverse mylitis in Dec 2007 and is 90 %Paralysed, He is bound to a wheelchair, this seems to have injected feul in him to help chemists all around the world, he is more active than before and is pushing boundaries, He has 100 million plus hits on Google, 2.5 lakh plus connections on all networking sites, 100 Lakh plus views on dozen plus blogs, 227 countries, 7 continents, He makes himself available to all, contact him on +91 9323115463, email amcrasto@gmail.com, Twitter, @amcrasto , He lives and will die for his family, 90% paralysis cannot kill his soul., Notably he has 38 lakh plus views on New Drug Approvals Blog in 227 countries......https://newdrugapprovals.wordpress.com/ , He appreciates the help he gets from one and all, Friends, Family, Glenmark, Readers, Wellwishers, Doctors, Drug authorities, His Contacts, Physiotherapist, etc He has total of 32 International and Indian awards

Verified Services

View Full Profile →

Archives

Categories

Flag Counter

Piecing together the puzzle: understanding a mild, metal free reduction method for large scale synthesis of hydrazines


DR ANTHONY MELVIN CRASTO Ph.D's avatarORGANIC CHEMISTRY SELECT

Piecing together the puzzle: understanding a mild, metal free reduction method for large scale synthesis of hydrazines

D.L. Browne,* I.R. Baxendale, S.V. Ley, Tetrahedron2011, 67, 10296-10303.

http://www.sciencedirect.com/science/article/pii/S0040402011015304

Full-size image (13 K)

A key intermediate for the synthesis of hydrazines via a mild, metal free reduction of diazonium salts has been isolated and characterized by X-ray analysis. The presence of this intermediate is general, as demonstrated by the preparation of a number of analogues. A discussion of the mechanism and potential benefits of such a process are also described.

View original post

What is a Drug Master File? by DR ANTHONY MELVIN CRASTO… An introduction with case study of an API


What is a Drug Master File? DR ANTHONY MELVIN CRASTO An introduction with case study of an API

…………….

Celgene oral Crohn’s drug GED-0301, Mongersen impresses in Phase II


Celgene签署$26亿协议获克罗恩病反义药物GED-0301

Nogra制药,Celgene

Nogra Pharma Limited

公司寡核苷酸(Oligonucleotides)

克罗恩病(Crohn’s disease)

Shares in Celgene Corp have risen steadily following promising mid-stage data of its closely-watched Crohn’s disease drug mongersen.

Company Nogra Pharma Ltd.
Description Antisense oligonucleotide targeting SMAD family member 7 (MADH7; SMAD7)
Molecular Target SMAD family member 7 (MADH7) (SMAD7)
Mechanism of Action
Therapeutic Modality Nucleic acid: Linear RNA: Antisense
Latest Stage of Development Phase II
Standard Indication Crohn’s disease
Indication Details Treat moderate to severe Crohn’s disease
Regulatory Designation
Partner

Celgene Corp.

Mongersen (GED-0301) from Celgene Corp. (NASDAQ:CELG) produced clinical remission rates as high as 65.1% in a Phase II trial in 166 patients with moderate to severe Crohn’s disease, according to an abstract published in advance of the United European Gastroenterology’s meeting in Vienna.

In the trial, 55% of patients receiving 40 mg/day of mongersen and 65.1% of those receiving 160 mg/day achieved clinical remission compared with 9.5% of placebo patients (p<0.0001 for both). A cohort receiving 10 mg/day achieved a clinical remission rate of 12.2%, which was not significantly better than placebo.

The study’s primary outcomes were clinical remission, defined by a CDAI score less than 150 at day 15 and maintained for more than two weeks, and safety. Mongersen was well-tolerated, and toxicities associated with systemically active antisense therapies were not observed.

The study’s secondary endpoint is clinical response, defined as a CDAI score reduction of 100 points at day 28. Those rates were dose-dependent: 36.6%, 57.5% and 72.1% for the low, medium and high doses compared with 16.7% for placebo.

Celgene said it plans to start Phase III testing of mongersen shortly. The company paid $710 million up front to obtain exclusive, worldwide rights to the antisense oligonucleotide targeting SMAD family member 7 (MADH7; SMAD7) from Nogra Pharma Ltd. (Dublin, Ireland) in April. Nogra is eligible for $1.9 billion in milestones, plus tiered single-digit royalties.

 GED-0301, an antisense oligonucleotide targeting the SMAD7 gene, is in phase II clinical trials at Nogra Pharma for the oral treatment of moderate to severe Crohn’s disease.

生物技术公司新基(Celgene)从爱尔兰制药商Nogra制药手中获得了一种处于后期临床开发的克罗恩病(Crohn’s disease)药物GED-0301。GED-0301是一种口服反义药物,靶向于Smad7信使RNA(mRNA),该药开发用于中度至重度克罗恩病 的治疗。反义药物是一种合成的核酸拷贝,旨在结合导致疾病的基因的mRNA,关闭基因的表达;口服;【Celgene签署$26亿协议获克罗恩病反义药物 GED-0301】http://www.hfoom.com/product/20140425/8311.html

 

Inflammatory bowel disease (IBD) is a chronic inflammatory disorder of the gastrointestinal tract suffered by approximately one million patients in the United States. The two most common forms of IBD are Crohn’s disease (CD) and ulcerative colitis (UC). Although CD can affect the entire gastrointestinal tract, it primarily affects the ilieum (the distal or lower portion of the small intestine) and the large intestine. UC primarily affects the colon and the rectum. Current treatment for both CD and UC include aminosalicylates (e.g., 5- aminosalicylic acid, sulfasalazine and mesalamine), antibiotics (e.g., ciprofloxacin and metronidazole), corticosteroids (e.g., budesonide or prednisone), immunosuppressants (e.g., azathioprine or methotrexate) and tumor necrosis factor (TNF) antagonists (e.g., infliximab (Remicade®)). Patient response to these therapies varies with disease severity and it can vary over cycles of active inflammation and remission. Moreover, many of the current therapies for IBD are associated with undesirable side effects.

Although the etiologies of CD and UC are unknown, both are considered inflammatory diseases of the intestinal mucosa. Recent studies have demonstrated that TGF-β 1 acts as a potent immunoregulator able to control mucosal intestinal inflammation. TGF-βΙ binds a heterodimeric transmembrane serine/threonine kinase receptor containing two subunits, TGF-βΙ Rl and TGF-βΙ R2. Upon ligand binding, the TGF-βΙ Rl receptor is phosphorylated by the constitutively active TGF-βΙ R2 receptor and signal is propagated to the nucleus by proteins belonging to the SMAD family. Activated TGF-β Ι Rl directly phosphorylates SMAD2 and SMAD3 proteins, which then interact with SMAD4. The complex of SMAD2/SMAD3/SMAD4 translocates to the nucleus and modulates the transcription of certain genes.

Additional studies have demonstrated that another SMAD protein, SMAD7, also plays a role in inflammation. SMAD7, an intracellular protein, has been shown to interfere with binding of SMAD2/SMAD3 to the TGF-βΙ Rl preventing phosphorylation and activation of these proteins. Further, increased expression of SMAD7 protein is associated with an inhibition of TGF-βΙ mediated-signaling. Mucosal samples from IBD patients are characterized by high levels of SMAD7 and reduced levels of phosphorylated-SMAD3 indicating that TGF-βΙ -mediated signaling is compromised in these patients.

Recent studies have focused on SMAD7 as a target for treating patients suffering from IBD.

Such therapies include anti-SMAD7 antisense therapies. As such, there is a need for methods based on predictive biomarkers that can be used to identify patients that are likely (or unlikely) to respond to treatment with anti- SMAD7 therapies.

GTCGCCCCTTCTCCCCGCAGC

GED-0301, Mongersen

Phosphorothioate antisense oligonucleotide targeting human mothers against decapentaplegic homolog 7 (SMAD7) gene, whose sequence is 5′-GTCGCCCCTTCTCCCCGCAGC-3′, wherein ‘C’ at postions 3 and 16 is 5-methyl 2′-deoxycytidine 5′-monophosphate

WO 2004087920

http://www.google.com/patents/WO2004087920A1?cl=en

…………………………

WO 2013037970

http://www.google.com/patents/WO2013037970A1?cl=en

…………………

WO 2013158868

http://www.google.com/patents/WO2013158868A1?cl=en

……………………………………………

WO 2014140333

http://www.google.com/patents/WO2014140333A1?cl=en

5*-GTCGCCCCTTCTCCCCGCAGC-3* (SEQ ID NO: 3).

 

Reference
1 BADARU, A.; PIHOKER, C.: ‘Type 2 diabetes in childhood: clinical characteristics and role of beta-cell autoimmunity‘ CURR. DIAB. REP. vol. 12, 2012, pages 75 – 81
2 * BHAT ET AL: “Antisense inhibition of 11betahydroxysteroid dehydrogenase type 1 improves diabetes in a novel cortisone-induced diabetic KK mouse model“, BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ACADEMIC PRESS INC. ORLANDO, FL, US, vol. 365, no. 4, 20 November 2007 (2007-11-20), pages 740-745, XP022384861, ISSN: 0006-291X, DOI: 10.1016/J.BBRC.2007.11.032
3 * GUTIERREZ-AGUILAR ET AL: “Minor contribution of SMAD7 and KLF10 variants to genetic susceptibility of type 2 diabetes“, DIABETES & METABOLISM, PARIS, AMSTERDAM, NL, vol. 33, no. 5, 10 October 2007 (2007-10-10), pages 372-378, XP022327080, ISSN: 1262-3636, DOI: 10.1016/J.DIABET.2007.06.002
4 * H. Y. CHEN ET AL: “The Protective Role of Smad7 in Diabetic Kidney Disease: Mechanism and Therapeutic Potential“, DIABETES, vol. 60, no. 2, 27 October 2010 (2010-10-27), pages 590-601, XP55071874, ISSN: 0012-1797, DOI: 10.2337/db10-0403
5 HONG, S. ET AL.: ‘Smad7 sensitizes tumor necrosis factor induced apoptosis through the inhibition of antiapoptotic gene expression by suppressing activation of the nuclear factor-kappaB pathway‘ CANCER RES. vol. 67, 2007, pages 9577 – 9583
6 HOOK, S. M. ET AL.: ‘Smad2: A candidate gene for the murine autoimmune diabetes locus Idd21.1‘ 1. CLIN. ENDOCRINOL. METAB. vol. 96, 2011, pages E2072 – E2077
7 KAWAMOTO, K. ET AL.: ‘Transforming growth factor beta 1 (TGF-?1) and rapamycin synergize to effectively suppress human T cell responses via upregulation of FoxP3+ Tregs‘ TRANSPL. IMMUNOL. vol. 23, 2010, pages 28 – 33
8 LI, M. O.; FLAVELL, R. A.: ‘TGF-beta: a master of all T cell trades‘ CELL vol. 134, 2008, pages 392 – 404
9 * LIANG Y ET AL: “Reduction in Glucagon Receptor Expression by an Antisense Oligonucleotide Ameliorates Diabetic Syndrome in db/db Mice“, DIABETES, AMERICAN DIABETES ASSOCIATION, US, vol. 53, February 2004 (2004-02), pages 410-417, XP002995165, ISSN: 0012-1797, DOI: 10.2337/DIABETES.53.2.410
10 * LU ZHU ET AL: “Unraveling the biological functions of Smad7 with mouse models“, CELL & BIOSCIENCE, BIOMED CENTRAL LTD, LONDON, UK, vol. 1, no. 1, 28 December 2011 (2011-12-28), page 44, XP021132085, ISSN: 2045-3701, DOI: 10.1186/2045-3701-1-44
11 LUO, X. ET AL.: ‘Systemic transforming growth factor-?1 gene therapy induces Foxp3+ regulatory cells, restores self-tolerance, and facilitates regeneration of beta cell function in overtly diabetic nonobese diabetic mice‘ TRANSPLANTATION vol. 79, 2005, pages 1091 – 1096
12 MARGOLLES-CLARK, E. ET AL.: ‘Small molecule costimulatory blockade: organic dye inhibitors of the CD40-CD154 interaction‘ J. MOL. MED. vol. 87, 2009, pages 1133 – 1143
13 * MIZOBUCHI TERUAKI ET AL: “Differential expression of Smad7 transcripts identifies the CD4+CD45RChigh regulatory T cells that mediate type V collagen-induced tolerance to lung allografts“, THE JOURNAL OF IMMUNOLOGY, THE AMERICAN ASSOCIATION OF IMMUNOLOGISTS, US, vol. 171, no. 3, 1 August 2003 (2003-08-01), pages 1140-1147, XP002430371, ISSN: 0022-1767
14 MONTELEONE, G. ET AL.: ‘A failure of transforming growth factor-?1 negative regulation maintains sustained NF-KB activation in gut inflammation‘ J. BIOL. CHEM. vol. 279, 2004, pages 3925 – 3932
15 MORITANI, M. ET AL.: ‘Abrogation of autoimmune diabetes in nonobese diabetic mice and protection against effector lymphocytes by transgenic paracrine TGF-?1‘ J. CLIN. INVEST. vol. 102, 1998, pages 499 – 506
16 * NORA G. SMART ET AL: “Conditional Expression of Smad7 in Pancreatic [beta] Cells Disrupts TGF-[beta] Signaling and Induces Reversible Diabetes Mellitus“, CELL, vol. 88, no. 2, 31 January 2006 (2006-01-31), page 561, XP55071875, ISSN: 0092-8674, DOI: 10.1371/journal.pbio.0040039
17 OLIVIERI, A. ET AL.: ‘Serum transforming growth factor ?1 during diabetes development in non-obese diabetic mice and humans‘ CLIN. EXP. IMMUNOL. vol. 162, 2010, pages 407 – 414
18 Remington’s Pharmaceutical Sciences‘, 1990, MACK PUBLISHING COMPANY
19 ROEP, B. O. ET AL.: ‘Satisfaction (not) guaranteed: re-evaluating the use of animal models of type 1 diabetes‘ NAT. REV. IMMUNOL. vol. 4, 2004, pages 989 – 997
20 * S. M. HOOK ET AL: “Smad2: A Candidate Gene for the Murine Autoimmune Diabetes Locus Idd21.1“, JOURNAL OF CLINICAL ENDOCRINOLOGY & METABOLISM, vol. 96, no. 12, 5 October 2011 (2011-10-05), pages E2072-E2077, XP55071877, ISSN: 0021-972X, DOI: 10.1210/jc.2011-0463
21 SHODA, L. K. ET AL.: ‘A comprehensive review of interventions in the NOD mouse and implications for translation‘ IMMUNITY vol. 23, 2005, pages 115 – 126
22 SMART, N. G. ET AL.: ‘Conditional expression of Smad7 in pancreatic beta cells disrupts TGF-beta signaling and induces reversible diabetes mellitus‘ PLOS BIOL. vol. 4, 2006, page E39
23 WALLBERG, M. ET AL.: ‘An islet-specific pulse of TGF-? abrogates CTL function and promotes ? cell survival independent of Foxp3+ T cells‘ J. IMMUNOL. vol. 186, 2011, pages 2543 – 2551
24 YAN, X.; CHEN, Y. G.: ‘Smad7: not only a regulator, but also a cross-talk mediator of TGF-beta signalling‘ BIOCHEM. J. vol. 434, 2011, pages 1 – 10
WO2003037368A2 * Oct 31, 2002 May 8, 2003 Andreas Steinbrecher Smad7 inhibitors for the treatment of cns diseases
WO2009129544A1 * Apr 20, 2009 Oct 22, 2009 Baxter International Inc. Microsphere-based composition for preventing and/or reversing new-onset autoimmune diabetes
WO2010054826A1 Nov 13, 2009 May 20, 2010 Giuliani International Limited Antisense compositions and methods of making and using same

Unanimous FDA panel support for Novartis’ secukinumab


Unanimous FDA panel support for Novartis' secukinumab

Unanimous FDA panel support for Novartis’ secukinumab

October 21, 2014

Kevin Grogan

Advisors to the US Food and Drug Administration have voted unanimously to support approval of Novartis’ secukinumab for moderate-to-severe plaque psoriasis.

The agency’s Dermatologic and Ophthalmic Drugs Advisory Committee voted 7-0  in favour of secukinumab, a selective interleukin-17A inhibitor, based on 10 Phase II/III clinical studies which included nearly 4,000 patients. Treatment with the drug has resulted in high rates of clear to almost clear skin at week 12 and it has shown superiority to Amgen’s Enbrel (etanercept), an anti-TNF standard of care.

PRANLUKAST


Pranlukast.svg

 

 

Chemical structure for Pranlukast

PRANLUKAST

Antiasthmatic.
  • Benzamide, N-(4-oxo-2-(1H-tetrazol-5-yl)-4H-1-benzopyran-8-yl)-4-(4-phenylbutoxy)-
  •  N-(4-Oxo-2-(1H-tetrazol-5-yl)-4H-1-benzopyran-8-yl)-p-(4-phenylbutoxy)benzamide
  • 4-Oxo-8-(4-(4-phenylbutoxy)benzoylamino)-2-(tetrazol-5-yl)-4H-1-benzopyran
  • N-(4-Oxo-2-(1H-tetrazol-5-yl)-4H-1-benzopyran-8-yl)-p-(4-phenylbutoxy)benzamide

 

Launched – 1995 japan
hemihydrate, 103177-37-3 anhydrous, 103180-28-5 (monosodium salt)
150821-03-7, C27 H23 N5 O4 . H2O, 499.5179
Ono-1078
Ono-RS-411
RS-411
SB-205312
Ono-1070 (monosodium salt)
 Ultair; Ono-1078; HY-B0290;
  • Azlaire
  • CCN 00401
  • ONO 1078
  • ONO-1078
  • ONO-RS 411
  • Pranlukast
  • RS 411
  • SB 205312
  • UNII-TB8Z891092
N-[4-Oxo-2-(1H-tetrazol-5-yl)-4H-1-benzopyran-8-yl]-4-(4-phenylbutoxy)benzamide hemihydrate
Ono (Originator)Schering-Plough (Licensee)
This is described in…………
J Med Chem 1988, 31(1): 84,
WO 2010002075,
Synth Commun 1997, 27(6): 1065,
WO 1994012492
Leukotriene antagonist.
Prepn: M. Toda et al., EP 173516eidem, US 4780469 (1986, 1988 both to Ono);
H. Nakai et al., J. Med. Chem. 31, 84 (1988).
Pharmacology: T. Obata et al., Adv. Prostaglandin Thromboxane Leukotriene Res. 15, 229 (1985); idem et al., ibid. 17,540 (1987).
Clinical evaluations in asthma: Y. Taniguchi et al., J. Allergy Clin. Immunol. 92, 507 (1993); H. Yamamoto et al. Am. J. Respir. Crit. Care Med. 150, 254 (1994).
AU 8546462; EP 0173516; JP 8650977; US 4780469; US 4939141
Pranlukast is a cysteinyl leukotriene receptor-1 antagonist. It antagonizes or reduces bronchospasm caused, principally in asthmatics, by an allergic reaction to accidentally or inadvertently encountered allergens.
 Pranlukast

Pranlukast is a cysteinyl leukotriene receptor-1 antagonist. This drug works similarly to Merck & Co.‘s Singulair (montelukast). It is widely used in Japan.

Medications of this class, which go under a variety of names according to whether one looks at the American, British or European system of nomenclature, have as their primary function the antagonism of bronchospasm caused, principally in asthmatics, by an allergic reaction to accidentally or inadvertently encountered allergens.

Medications of this group are normally used as an adjunct to the standard therapy of inhaled steroids with inhaled long- and/or short-acting beta-agonists. There are several similar medications in the group; all appear to be equally effective.

Pranlukast hydrate is a leukotriene CysLT1 (LTD4) and CysLT2 (LTC4) antagonist first launched in Japan in 1995 as capsules for the oral treatment of bronchial asthma and allergic rhinitis. A dry syrup formulation of pranlukast for the treatment of asthma was approved in Japan in 1999. In April 2011, Ono filed a regulatory application in Japan seeking approval of the compound for the treatment of allergic rhinitis in pediatric patients. In December 2011, approval was obtained for this indication and launch took place immediately.

In terms of clinical development, Ono had been evaluating the drug in phase III for the treatment of sinusitis; however, in 2008 the compound was discontinued for this indication when the compound failed to demostrate the expected efficacy in the phase III studies. In March 2006, Ono discontinued development of the compound for the oral treatment of chronic obstructive pulmonary disease (COPD) based on results which suggested no evidence of efficacy. In 2000, Ono signed a license agreement with Schering-Plough to develop and market pranlukast hydrate in Latin America.

Chemical structure for Pranlukast hemihydrate

Pranlukast hemihydrate

Also known as: RTR-006167; 150821-03-7…………..http://chem.sis.nlm.nih.gov/chemidplus/rn/150821-03-7
  • Benzamide, N-(4-oxo-2-(1H-tetrazol-5-yl)-4H-1-benzopyran-8-yl)-4-(4-phenylbutoxy)-, hydrate (2:1)

UNII-FR702N558K

4-Oxo-8-[(4-phenylbutoxy)benzoylamino]-2-(tetrazol-5-yl)-4H-1-benzopyran · 1/2 hydrate (common name: pranlukast, hereinafter referred to as “pranlukast” in the specification including the claims) represented by formula:

Figure 00010001

is a compound having a potential antagonistic action against leucotriene C4(LTC4) and leucotriene D4 (LTD4) and is expected as a treating agent for allergic bronchial or pulmonary diseases, allergic shock, and various allergic inflammatory diseases.

Pranlukast
Pranlukast.svg
Systematic (IUPAC) name
N-[4-oxo-2-(1H-tetrazol-5-yl)-4H-chromen-7-yl]-4-(4-phenylbutoxy)benzamide
Clinical data
AHFS/Drugs.com International Drug Names
Legal status
?
Routes Oral
Pharmacokinetic data
Metabolism Hepatic (mainly CYP3A4)[1]
Half-life 1.5 hours[1]
Identifiers
CAS number 103177-37-3 Yes
ATC code R03DC02
PubChem CID 4887
DrugBank DB01411
ChemSpider 4718 Yes
UNII TB8Z891092 Yes
ChEMBL CHEMBL21333 Yes
Chemical data
Formula C27H23N5O4 
Mol. mass 481.503 g/mol
Toda synthetic complete with 3 – nitro-2 – hydroxyphenyl ko one for raw materials, ni ko with oxalic ester Claisen condensation occurs, and then heated to reflux for cyclization to construct benzo pyran ring; dehydrated by an amide synthesized ring cyano group, the cyano compound and then with sodium azide tetrazole synthesis. The nitro group on the compound in 5% Pd / C catalyzed hydrogenation of amino acid reacted with the compound Pranlukast held. This method directly using 4 – (4 – phenyl-butoxy)-benzoic acid reaction. Synthetic route is as follows:
[0006]
Figure CN101450943BD00051
[0007]
Figure CN101450943BD00061
[0008] ② Robert Graham and routes are routes to I-bromo-butane as a raw material, were used as a palladium catalyst, ligand compound formylation carbonylation reactions and condensation of potassium tert-butoxide, closed dehydration under acidic conditions benzopyran ring method. Synthetic route is as follows:
[0009] Robert routes:
[0010]
Figure CN101450943BD00062
[0011] Graham route:
[0012]
Figure CN101450943BD00071
[0013] The two synthetic routes are not disclosed in the I-Bromo butane feedstock pathway.
[0014] ③ Masayohi 2_ cyano synthetic route to a benzopyran derivative and hydrogen sulfide gas in the base-catalyzed addition reaction of 2 – thiocarbamoylbenzothiazol and pyran derivatives, and then were reacted with anhydrous hydrazine group hydrazone, with sodium nitrite under acidic conditions nitrosation reaction occurs tetrazole ring. Synthetic route is as follows:
[0015]
Figure CN101450943BD00081
[0016] The materials used are not mentioned route synthesis method, it is only reflected in the improvement of the synthesis of the tetrazole ring.
[0017] ④ Giles, Hideki and Hayler are tetrazole substituent on the increase, making it easier condensation reaction, but the synthesis of substituted on the nitrogen with tetrazole difficult, and ultimately elimination reaction of lithium used tetrahydro aluminum and other hazardous reagents, is not easy to Eri industrialization. Reaction scheme is as follows:
[0018]
Figure CN101450943BD00082
[0019] ⑤ Lee NK with 4_ (4_ Phenylbutoxy) benzonitrile and 2_ hydroxy _3_ iodobenzene ko 1H_4_ thiazolyl ketone and ester ko _5_ acid, concentrated sulfuric acid catalyzed cyclization iodide copper and potassium phosphate removal under the action of hydrogen iodide get Pranlukast held. Reaction scheme is as follows:
Figure CN101450943BD00091
[0021] does not mention the route starting 4 – (4 – phenyl-butoxy)-benzonitrile synthesis method, while two – hydroxy – 3 – Synthesis of iodobenzene ko difficult one.
The synthesis method comprises the following steps: a. 4 – Synthesis of chlorobutanol THF was added concentrated hydrochloric acid, feeding the mass ratio of I: I. 389 ~ 5. 556,45-80 ° C was stirred for 5-18h, cooled, extracted with methylene chloride, removal of the solvent, distillation under reduced pressure to give 4 – chlorobutanol; b. 4 – phenyl butanol take benzene, aluminum chloride mixture ,0-25 ° C solution of 4 – chlorobutanol, reaction 5 -10h then poured into ice-water, a liquid, in addition to homogeneous solution U, distillation under reduced pressure, and the resulting colorless transparent liquid that is, 4 – phenyl butanol; c. I-bromo-4 – phenyl butane synthesis of 4 – phenyl butanol 40% hydrobromic acid mixture, feeding the mass ratio of I: 2. 857 ~ 11. 428, heat refluxing, cooling, liquid separation, the organic solvent divided by distillation under reduced pressure to give I-bromo-4 – phenyl butane; d. Synthesis of methyl p-hydroxybenzoate take-hydroxybenzoic acid and methanol, concentrated sulfuric acid and refluxed for 5-20h spin methanol, poured into cold water to precipitate a white solid which was filtered and dried to give the hydroxy benzoate; e. 4 – (4 – phenyl-butoxy)-benzoic acid methyl ester _ take I-bromo-4 – phenyl butane,
DMF, toluene, methyl p-hydroxybenzoate and potassium carbonate, a reflux 5 ~ 20h, cooling water, extracted with toluene, light yellow liquid rotary evaporation, recrystallization, and the resulting white solid, that is, 4 – (4 – phenyl-butoxy) – benzoic acid methyl ester; f. 4 – (4 – phenyl-butoxy yl) – benzoic acid taken 4 – (4 – phenyl-butoxy) – benzoic acid methyl ester, 15% NaOH solution was refluxed for I ~ 5h, cooled, acidified, filtered and dried to give 4 – (4 – phenylbutyrate oxy) – benzoic acid; g. sprinkle bromophenyl acetic acid ester molar ratio Preparation of I: I ~ I. 5: O. I ~ I of bromophenol, acetic anhydride, pyridine feeding, reflux 3 ~ 10h, distilled pyridine, acetic acid and excess acetic anhydride distilled under reduced pressure to give the acetic acid esters bromophenol; h. 5 – bromo-2 – Preparation of light taken acetophenone molar ratio of I: I ~ 5: I of acetic acid bromophenol esters, aluminum chloride, tetrachlorethylene for feeding, reflux O. 5 ~ 5. 5h, cooled, the reaction solution was poured into 5% hydrochloric acid and extracted with methylene chloride, the solvent evaporated under reduced pressure, to obtain a gray crystalline 5 – bromo-2 – Light acetophenone; i. 5 – bromo-3 – nitro-2 – Preparation of light acetophenone take 5 – bromo-2 – Light acetophenone, carbon tetrachloride, 50 ~ 90 ° C is added dropwise nitric acid, reflux I ~ 4h, cooled, filtered, and the resulting yellow solid which is 5 – bromo-3 – nitro-2 – hydroxyacetophenone; j. 3 – amino-2 – Light benzene ethanone Preparation of 5 – bromo-3 – nitro-2 – hydroxyacetophenone, 5% Pd / C, methylene chloride, methanol, concentrated hydrochloric acid, water, hydrogenation; the end of the reaction mixture was filtered, the filtrate was The solvent was removed, neutralized with sodium bicarbonate, and the resulting yellow solid ginger i.e., 3 – amino-2 – hydroxyacetophenone; k. 3 – [4 – (4 – phenyl-butoxy)-benzoyl amino] -2 _ light base Preparation of acetophenone 4 – (4 – phenyl-butoxy)-benzoic acid, toluene, DMF, 45 ~ 105 ° C was added dropwise SOCl2, 30min the reaction liquid droplets to the 3 – amino-2 – hydroxyphenyl toluene solution of ethyl ketone, the reaction 3 ~ 10h, cooled, neutralized with dilute hydrochloric acid, extracted with toluene, rotary evaporation, and the resulting pale yellow crystals is 3 – [4 – (4_ phenylbutoxy) benzamido] 2_-hydroxyacetophenone; I. 2 – [4 – (4 – phenyl-butoxy)-benzoyl amino] -6 – [l, 3 – dioxo-3 – ethoxycarbonyl-propyl] phenol synthetic sodium, THF, 3 – [4 – (4 – phenyl-butoxy)-benzoyl amino]-2 – hydroxyacetophenone, diethyl oxalate 4 ~ IOh After stirring the reaction was poured into dilute hydrochloric acid to precipitate the yellow solid which was filtered, and the resulting product, i.e. 2 – [4 – (4_ phenylbutoxy) benzamido] _6_ [1,3 – dioxo-3 – ethoxy propyl intended yl] phenyl discretion ·; m. 4 – oxo-8 – [4 – (4 – phenyl-butoxy)-benzoyl amino]-2 – ethoxycarbonyl-4H-benzopyran take 2 – [4 – (4 – phenyl-butoxy yl) benzoyl amino] -6 – [l, 3 – dioxo-3 – ethoxycarbonyl-propyl] phenol, THF, force mouth heat, the addition of concentrated hydrochloric acid, refluxed for 8 ~ 15h, cooled, filtered, and the resulting white solid,
that is, 4 – oxo-8 – [4 – (4 – phenyl-butoxy)-benzoyl amino]-2 – ethoxycarbonyl-4H-benzopyran; η. 4 – oxo-8 – [ 4 – (4 – phenyl-butoxy)-benzoyl amino] -2 – amino-carbonyl-4Η-benzopyran synthesis take four – oxo-8 – [4 – (4 – phenyl-butoxy)-benzoyl amino] -2 – ethoxycarbonyl-4Η-benzopyran was dissolved in DMF,
and leads to dry ammonia gas, the reaction solution changed from yellow to red, the reaction solution was poured into cold water, adjusted to acidic, and filtered to give the product 4 – oxo-8 – [4 – (4 – phenyl-butoxy)-benzoyl amino] -2 – amino-carbonyl-4Η-benzopyran; P. 4 – oxo-8 – [4 – (4 – phenylbutoxy) benzamido] -2 – cyano-4Η-benzopyran take DMF, S0C12, 4 – oxo-8 – [4 – (4 – phenyl-butoxy)-benzoic amido] _2_ aminocarbonyl-4H-benzopyran, O ~ 15 ° C under stirring for 2 ~ IOh poured into cold water, filtered, and the resulting white solid that is, 4 – oxo-8 – [4 – (4 – phenylbutoxy) benzamido] -2 – cyano-4H-benzopyran; q. Synthesis of pranlukast take four – oxo-8 – [4 – (4 – phenyl-butoxy) benzoyl amino]-2_ cyano-4H-benzopyran, ammonium chloride, sodium azide, DMF, heating I ~ 8h then poured into ice-water, dilute hydrochloric acid, filtered, and the resulting white solid that the final product Pranlukast.
The reaction of ethyl 8-nitro-4-oxo-1-benzopyran-2-carboxylate (I) with ammonia in methanol gives the corresponding amide (II), which is dehydrated with POCl3 yielding 2-cyano-8-nitro-1-benzopyran-4-one (III). The cyclization of (III) with sodium azide by means of pyridinium chloride in hot DMF affords 8-nitro-2-(tetrazol-5-yl)-1-benzopyran-4-one (IV), which is hydrogenated with H2 over Pd/C in methanol – HCl giving 8-amino-2-(tetrazol-5-yl)-1-benzopyran-4-one (V). Finally, this compound is condensed with 4-(4-phenylbutoxy)benzoic acid (VI) by means of oxalyl chloride in dichloromethane-pyridine\
………………………..

Synthetic routes
The reaction of ethyl 8-nitro-4-oxo-1-benzopyran-2-carboxylate (I) with ammonia in methanol gives the corresponding amide (II), which is dehydrated with POCl3 yielding 2-cyano-8-nitro-1- benzopyran-4-one (III). The cyclization of (III) with sodium azide by means of pyridinium chloride in hot DMF affords 8-nitro-2- (tetrazol-5-yl) -1-benzopyran-4-one (IV ), which is hydrogenated with H2 over Pd / C in methanol -. HCl giving 8-amino-2- (tetrazol-5-yl) -1-benzopyran-4-one (V) Finally, this compound is condensed with 4- (4-phenylbutoxy) benzoic acid (VI) by means of oxalyl chloride in dichloromethane-pyridine.
……………………………………
PATENT

Example 1: Synthesis of pranlukast

To 10 g of N-(4-oxo-2-(l-trityl-lH-tetrazol-5-yl)-4H-chromen-8-yl)-4-(4- phenylbutoxy) benzamide (Pharmacostech) was added 100 ml of methanol, and 10 g of a resin pre-treated with hydrochloric acid of pH 2-3 (TRILITE SCR-B gel type,

Mitsubishi Chemical Co.) was added to the reaction mixture, followed by refluxing for

5 hours. The solid components were filtered out from the reaction mixture and washed with 100 ml of methanol. The filter-in solution was subject to vacuum distillation to obtain a solid substance and the solid was dissolved in 50 ml of dimethyl acetamide (DMAC). Afterwards, 200 ml of aqueous solution was added to the DMAC solution and stirred for 1 hour at room temperature. Then, the solid formed was filtered out, dried, and left for 5 hours at room temperature to give 6.32 g (yield:

95%) of the standard compound represented by the following Formula 5: melting point, 231-2330C (decomposed); 1H-NMR (DMSOd6, 300 MHz), δ 1.9 (m, 4H), 2,7 (m,2H), 4.0 (t, 2H), 7.0 (s, 2H), 7.1 (s, IH), 7.2-7.3 (m, 5H), 7.6 (t, IH), 7.9 (t, IH), 8.0

(m, 2H), 8.3 (t, IH), 10.0 (bs, IH).

Example 2: Synthesis of pranlukastOne hundred ml of methanol was added to 10 g of N-(4-oxo-2-(l-trityl-lH- tetrazol-5-yl)-4H-chromen-8-yl)-4-(4-phenylbutoxy) benzamide (Pharmacostech), then 10 g of resin pre-treated with hydrochloric acid of pH 2-3 (TRILITE SCR-10 gel type, Mitsubishi Chemical Co.) was added to the reaction mixture, followed by refluxing for 6 hours. The solid components were filtered out from the reaction mixture and washed with 100 ml of methanol. The filter-in solution was subject to vacuum distillation to obtain a solid substance and the solid was dissolved in 50 ml of dimethyl acetamide (DMAC). Afterwards, 200 ml of aqueous solution was added to the DMAC solution and stirred for 1 hour at room temperature. Then the solid formed was filtered out, dried, and left for 5 hours at room temperature to obtain 6.18 g (yield rate: 93%) of the standard compound represent by Formula 5: melting point, 231- 233°C (decomposed); 1H-NMR (DMSOd6, 300 MHz), δ 1.9 (m, 4H), 2,7 (m, 2H), 4.0 (t, 2H), 7.0 (s, 2H), 7.1 (s, IH), 7.2-7.3 (m, 5H), 7.6 (t, IH), 7.9 (t, IH), 8.0 (m, 2H), 8.3 (t, IH), 10.0 (bs, IH).

Example 3: Synthesis of pranlukast

One hundred ml of methanol and 100 ml of methylene chloride (MC) were added to 10 g of N-(4-oxo-2-(l-trityl-lH-tetrazol-5-yl)-4H-chromen-8-yl)-4-(4- phenylbutoxy) benzamide (Pharmacostech), then 10 g of resin pre-treated with hydrochloric acid of pH 2-3 (TRILITE SCR-10 gel type) was added to the reaction mixture, followed by refluxing for 12 hours. The solid components were filtered out from the reaction mixture and washed with 100 ml of methanol. The filter-in solution was subject to vacuum distillation to obtain a solid substance and the solid was dissolved in 50 ml of dimethyl acetamide (DMAC). Afterwards, 200 ml of aqueous solution was added to the DMAC solution, and stirred for 1 hour at room temperature. Then the solid formed was filtered out, dried, and left for 5 hours at room temperature to obtain 6.18 g (yield rate: 93%) of the standard compound represent by Formula 5: melting point, 231-233°C (decomposed); 1H-NMR (DMSO-d6, 300 MHz), δ 1.9 (m, 4H), 2,7 (m, 2H), 4.0 (t, 2H), 7.0 (s, 2H), 7.1 (s, IH), 7.2-7.3 (m, 5H), 7.6 (t, IH), 7.9 (t, IH), 8.0 (m, 2H), 8.3 (t, IH), 10.0 (bs, IH).

……………………………………………………….

Pranlukast and its hydrates come into the market as a capsule of Onon® Cap. (112.5 mg pranlukast hydrates/capsule, Dong-A Pharmaceutical).

Figure imgf000003_0001

The conventional method for preparing pranlukast was disclosed in US Pat. No. 5,587,483 and pranlukart is prepared by the following reaction formula I.

Reaction Formula I

Figure imgf000003_0002

As described in the reaction formula I, the acid chloride represented by formula 11 is obtained by reacting the benzoic derivative of formula 10 with the thionyl chloride. The resulting compound is reacted with the compound represented by formula 4. The compound (n = 4) represented by formula 5 is reacted with the tetrazol derivative represented by formula 6 to introduce tetrazol group and then benzopyran ring is formed, preparing pranlukast. However, the preparation method according to the reaction formula I has quite a few problems: (a) difficult manipulation due to utilizing excess amounts of toxic thionyl chlorides around a reflux temperature when the acid chloride represented by formula 11 is obtained by reacting the benzoic derivative of formula 10 with the thionyl chloride;

(b) hard elimination of thionyl chlorides toxic in a body after terminating the reactions; (c) requirement of base in an equivalent ratio of above 4 to collect the compound represented by formula 7; (d) unsuitability of massive production in a economical area because the compound is modified into a form of natrium salt and then purified for removal of contaminants after preparing pranlukart.

On the other hand, as described in the following reaction formula II in US Pat. No. 5,874,593, nitril compounds of formula 8 are reacted with hydrazine to prepare amidrazone compounds of formula 9a and 9b, and then pranlukart is fabricated by performing a tetrazol ring reaction using nitrous acids.

Reaction Formula II

Figure imgf000004_0001

However, the preparation method according to the reaction formula II has also the following difficulties: (a) it is difficult to perform the method due to utilizing excess amounts of toxic thionyl chlorides around a reflux temperature to obtain the acid chloride derivative in the preparation of the compounds represented by formula 8; (b) it is very difficult and toxic in body to eliminate thionyl chlorides after terminating the reactions; (c) it is not easy to massively produce the compounds of interest in an industrial-scale because much hydrazine toxic in body and nitrogen oxides harmful in environment are generated and unstable nitrous acids are used during the reactions.

Likewise, US Pat. No. 5,874,593, as described in the following reaction formula III, discloses that benzoic derivatives of formula 10′ are reacted with oxalyl chlorides to isolate acid chlorides represented by formula 11′, and the resulting acid chlorides are reacted with benzopyran amine derivatives containing tetrazol of formula 12, producing various derivatives containing pranlukart.

 

Reaction Formula III

Figure imgf000005_0001

( I D’ ] (H ‘ )

Figure imgf000005_0002

Oxalyl chlorides are massively used because the preparation method according to the reaction formula III is very expensive cost and has highly hygroscopic characteristics. In addition, the method has to be carried out under violent conditions that the temperature is increased up to around reflux temperature using 1,2- dichloroethanol as a solvent and further reacted for 1 hr. It is also difficult to remove harmful carbon monoxide and chlorine gases massively generated in elimination of oxalyl chloride after terminating the reactions, and it is not feasible to be applied into an industrial mass-production because the reaction is carried out under conditions of anhydrous and inactive gases

 

EXAMPLE 1: Preparation of Pranlukart Hemihydrates 4-(4-phenylbutoxy)benzoic acid (29.1 g; 1.1 equivalent ratio; prepared according to the method disclosed in US Pat. No. 4,780,469) was dissolved in 80 ml dimethylacetamide (DMAC, Aldrich) at 00C and then thionyl chloride (14.2 g, 1.2 equivalent ratio, Aldrich) was gradually added to the solution. After the mixture solution was stirred for 10 min at 00C, the mixture of 8-amino-4-oxo-tetrazol-5-yl-4H- 1-benzopyran hydrochloride salt (26.7 g; 1 equivalent ratio; prepared according to the method disclosed in US Pat. No. 4,780,469) and triethylamine (TEA, 10.1 g, 1 equivalent ratio, Aldrich) dissolved in 80 ml dimethylacetamide (DMAC, Aldrich) was slowly added to the mixture solution, and thermally stirred for 5 hrs at 25°C.

The reaction mixture was mixed with 300 ml H2O and stirred for 1 hr at 250C. The solid material obtained by filtering the solid material produced was washed with 100 ml H2O. 200 ml 50% acetone aqueous solution was added to the solid material and then refluxed for 1 hr. After the reaction mixture was cooled to room temperature, filtered and air-dried, the mixture was kept to stand on air for 5 hrs, obtaining 47.0 g pranlukart hemihydrates (yield rate: 98%): melting point 231-233°C (decomposition); 1H-NMR (DMSO-d6, 300 MHz) δ 1.9 (m, 4H), 2,7 (m, 2H), 4.0 (t, 2H), 7.0 (s, 2H), 7.1 (s, IH), 7.2-7.3 (m, 5H), 7.6 (t, IH), 7.9 (t, IH), 8.0 (m, 2H), 8.3 (t, IH), 10.0 (bs, IH).

EXAMPLE 2: Preparation of Pranlukart Hemihydrates – Substitution of the Chlorinating Agent

4-(4-phenylbutoxy)benzoic acid (29.1 g, 1.1 equivalent ratio) was dissolved in 80 ml dimethylacetamide (DMAC) at 00C and then oxalyl chloride (15.2 g, 1.2 equivalent ratio, Aldrich) was gradually added to the solution. After the mixture solution was stirred for 10 min at 00C, the mixture of 8-amino-4-oxo-tetrazol-5-yl-4H- 1-benzopyran hydrochloride salt (26.7 g; 1 equivalent ratio) and triethylamine (TEA, 10.1 g, 1 equivalent ratio) dissolved in 80 ml dimethylacetamide (DMAC) solution was slowly added to the mixture solution, and thermally stirred for 5 hrs at 25°C.

The reaction mixture was mixed with 300 ml H2O and stirred for 1 hr at 25°C. The solid material obtained by filtering the solid material produced was washed with 100 ml H2O. 200 ml 50% acetone aqueous solution was added to the solid material and then refluxed for 1 hr. After the reaction mixture was cooled to room temperature, filtered and air-dried, the mixture was kept to stand on air for 5 hrs, obtaining 43.3 g pranlukart hemihydrates (yield rate: 92%).

EXAMPLE 3: Preparation of Pranlukart Hemihydrates – Change of Base Condition

4-(4-phenylbutoxy)benzoic acid (29.1 g, 1.1 equivalent ratio) was dissolved in 80 ml dimethylacetamide (DMAC) at 00C and then thionyl chloride (14.2 g, 1.2 equivalent ratio) was gradually added to the solution. After the mixture solution was stirred for 10 min at 00C, the mixture of 8-amino-4-oxo-tetrazol-5-yl-4H-l-benzopyran hydrochloride salt (26.7 g; 1 equivalent ratio) and pyridine (7.9 g, 1 equivalent ratio, Aldrich) dissolved in 80 ml dimethylacetamide (DMAC) solution was slowly added to the mixture solution, and thermally stirred for 5 hrs at 25°C.

The reaction mixture was mixed with 300 ml H2O and stirred for 1 hr at 25°C. The solid material obtained by filtering the solid material produced was washed with 100 ml H2O. 200 ml 50% acetone aqueous solution was added to the solid material and then refluxed for 1 hr. After the reaction mixture was cooled to room temperature, filtered and air-dried, the mixture was kept to stand on air for 5 hrs, obtaining 45.6 g pranlukart hemihydrates (yield rate: 95%).

EXAMPLE 4: Preparation of Pranlukart Hemihydrates – Change of Reaction Temperature Condition

4-(4-phenylbutoxy)benzoic acid (29.1 g, 1.1 equivalent ratio) was dissolved in 80 ml dimethylacetamide (DMAC) at 00C and then thionyl chloride (14.2 g, 1.2 equivalent ratio) was gradually added to the solution. After the mixture solution was stirred for 10 min at O0C, the mixture of 8-amino-4-oxo-tetrazol-5-yl-4H-l-benzopyran hydrochloride salt (26.7 g; 1 equivalent ratio) and triethylamine (TEZ, 10.1 g, 1 equivalent ratio) dissolved in 80 ml dimethylacetamide (DMAC) solution was slowly added to the mixture solution, and thermally stirred for 4 hrs at 500C. The reaction mixture was mixed with 300 ml H2O and stirred for 1 hr at 500C. The solid material obtained by filtering the solid material produced was washed with 100 ml H2O. 200 ml 50% acetone aqueous solution was added to the solid material and then refluxed for 1 hr. After the reaction mixture was cooled to room temperature, filtered and air-dried, the mixture was kept to stand on air for 5 hrs, obtaining 45.6 g pranlukart hemihydrates (yield rate: 95%).

EXAMPLE 5: Preparation of Pranlukart Hemihydrates – Substitution of Reaction Solvent 4-(4-phenylbutoxy)benzoic acid (29.1 g, 1.1 equivalent ratio) was dissolved in 80 ml N-methylpyrrolidine (NMP, Aldrich) at O0C and then thionyl chloride (14.2 g, 1.2 equivalent ratio) was gradually added to the solution. After the mixture solution was stirred for 10 min at 00C, the mixture of 8-amino-4-oxo-tetrazol-5-yl-4H-l-benzopyran hydrochloride salt (26.7 g; 1 equivalent ratio) and triethylamine (TEZ, 10.1 g, 1 equivalent ratio) dissolved in 80 ml N-methylpyrrolidine (NMP) solution was slowly added to the mixture solution, and thermally stirred for 4 hrs at 250C. The reaction mixture was mixed with 300 ml H2O and stirred for 1 hr at 25°C.

The solid material obtained by filtering the solid material produced was washed with 100 ml H2O. 200 ml 50% acetone aqueous solution was added to the solid material and then refluxed for 1 hr. After the reaction mixture was cooled to room temperature, filtered and air-dried, the mixture was kept to stand on air for 5 hrs, obtaining 43.3 g pranlukart hemihydrates (yield rate: 90%).

EXAMPLE 6: Preparation of Pranlukart Hemihydrates – Equivalent Ratio Change of the Chlorinating Agent

4-(4-phenylbutoxy)benzoic acid (29.1 g, 1.1 equivalent ratio) was dissolved in 80 ml dimethylacetamide (DMAC) at 00C and then thionyl chloride (14.2 g, 1 equivalent ratio) was gradually added to the solution. After the mixture solution was stirred for 10 min at 00C, the mixture of 8-amino-4-oxo-tetrazol-5-yl-4H-l-benzopyran hydrochloride salt (26.7 g, 1 equivalent ratio) and triethylamine (TEZ, 10.1 g, 1 equivalent ratio) dissolved in 80 ml dimethylacetamide (DMAC) solution was slowly added to the mixture solution, and thermally stirred for 4 hrs at 25°C.

The reaction mixture was mixed with 300 ml H2O and stirred for 1 hr at 25°C. The solid material obtained by filtering the solid material produced was washed with 100 ml H2O. 200 ml 50% acetone aqueous solution was added to the solid material and then refluxed for 1 hr. After the reaction mixture was cooled to room temperature, filtered and air-dried, the mixture was kept to stand on air for 5 hrs, obtaining 44.6 g pranlukart hemihydrates (yield rate: 93%).

……………………..

J. Med. Chem., 1988, 31 (1), pp 84–91
DOI: 10.1021/jm00396a013
…………………………………………………..
Geen, G.R.; Giles, R.G.; Grinter, T.J.; Hayler, J.D.; et al.
A direct and high yielding route to 2-(5-tetrazolyl) substituted benzopyran-4-ones: Synthesis of pranlukast
Synth Commun 1997, 27(6): 1065
 A direct and high yielding route to 2-(5-tetrazolyl)benzopyran-4-ones 1, including pranlukast 1a is described. This involves the Claisen condensation reaction between the relevant hydroxyacetophenone 2 and the ethyl ester of tetrazole-2-carboxylic acid 5 to give the 1,3-diketone 6, which is then cyclised to give the desired benzopyran-4-ones 1.\
………………………………………………..
WO 1994012492

References

  1. Nakade S, Ueda S, Ohno T, Nakayama K, Miyata Y, Yukawa E, Higuchi S (2006). “Population pharmacokinetics of pranlukast hydrate dry syrup in children with allergic rhinitis and bronchial asthma.”. Drug Metab Pharmacokinet 21 (2): 133–9. doi:10.2133/dmpk.21.133. PMID 16702733.

 

 

PRANLUKAST

Advanced Intermediate Flow Studies: Nevirapine


totallymicrowave's avatarSynthFlow

After looking through a number of flow articles that describe and illustrate processes toward the production of drug final products and advanced intermediates, I thought an article from Florida State — Tyler McQuade (open source Beilstein JOC 2013) was informative and storytelling. He was able to show some of the challenges that go into designing a flow methodology around process that have already been worked out in batch mode, and had been looked at in a number of labs already.

Before talking about the chemistry, Professor McQuade talks about a number of concerns in transferring technology from batch to flow: DOE, solvent exchange (precipitation and moving from one reaction to another), Cost of Goods Analysis – reaction concentrations, solvent costs, process time, by-product formation and purification. There certainly is a lot that goes into the strategy. To give you the framework: this group was looking to make a continuous process…

View original post 247 more words

System Suitability for USP Chromatographic Methods


DR ANTHONY MELVIN CRASTO Ph.D's avatarDRUG REGULATORY AFFAIRS INTERNATIONAL

System Suitability for USP Chromatographic Methods
How should system suitability tests (SSTs) be structured for USP monographs? More about USP experts group’s recommendations on the parameters and acceptance criteria for SSTs and the essential aspects of this new approach can be found in this News.

read

http://www.gmp-compliance.org/enews_4539_System-Suitability-for-USP-Chromatographic-Methods_9150,8369,8488,Z-QCM_n.html

An interesting article from the USP experts group “Small Molecules” has been published in the Pharmacopoeial Forum 39(5). It deals with USP’s future requirements regarding system suitability tests (SST).

SSTs are performed each time an analytical method is used. Together with instruments qualification and methods validation, the SST ensures the quality of analytical test results. The SST shows that a procedure and an instrumental system are performing as they did when the procedure was validated and that the method is thus “fit for purpose” for the intended use.

General requirements can be found in the USP Chapter <621> Chromatography which also contains provisions and acceptance…

View original post 116 more words

EPILEPSY AND SEIZURES ; 100% CURABLE BY AYURVEDA AND AYUSH TREATMENT


NEWDRUGAPPROVALS Touches 4 lakh views in 198 countries


Inline image 1
NEW DRUG APPROVALS BLOG ON A HIGH

 

NEW DRUG APPROVALS

ALL ABOUT DRUGS, LIVE, BY DR ANTHONY MELVIN CRASTO, WORLDDRUGTRACKER, HELPING MILLIONS, 7 MILLION HITS ON GOOGLE, PUSHING BOUNDARIES, ONE LAKH PLUS CONNECTIONS WORLDWIDE, 4 LAKHS PLUS VIEWS ON THIS BLOG IN 198 COUNTRIES

 

DR ANTHONY, WORLDDRUGTRACKER, HELPING MILLIONS
ANTHONY MELVIN CRASTO

THANKS AND REGARD’S
DR ANTHONY MELVIN CRASTO Ph.D

amcrasto@gmail.com

MOBILE-+91 9323115463
GLENMARK SCIENTIST ,  INDIA

Final Concept Paper ICH Q12: Technical and Regulatory Considerations for Pharmaceutical Product Lifecycle


DR ANTHONY MELVIN CRASTO Ph.D's avatarDRUG REGULATORY AFFAIRS INTERNATIONAL

Final Concept Paper ICH Q12: Technical and Regulatory Considerations for Pharmaceutical Product Lifecycle
Currently, there are no harmonised approaches to technical and regulatory considerations for the lifecycle management of pharmaceutical products. Therefore, ICH has just published a Final Concept Paper for a new ICH Q12 Guideline: Technical and Regulatory Considerations for Pharmaceutical Product Lifecycle. The proposed ICH Guideline is intended to fill this gap. read

http://www.gmp-compliance.org/enews_4533_Final-Concept-Paper-ICH-Q12-Technical-and-Regulatory-Considerations-for-Pharmaceutical-Product-Lifecycle_8348,8360,Z-PDM_n.html

ICH has just published a Final Concept Paper for a new ICH Q12 guideline: Technical and Regulatory Considerations for Pharmaceutical Product Lifecycle.

Currently, there is a lack of a harmonised approach to technical and regulatory considerations for the lifecycle management of pharmaceutical products. Although there are concepts in ICH Q8, Q9, Q10 and Q11 for a more science and risk-based approach for assessing changes across the lifecycle, several gaps exist which hinder a full realization of the benefits intended. The original aim of ‘operational flexibility’…

View original post 305 more words